Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen with PPIA ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR primers were custom-synthesized by Invitrogen-Life Technologies or Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen and designed for the human sequences of cholesterol biosynthesis pathway genes ...
-
bioRxiv - Neuroscience 2023Quote: ... All PCR primers were synthesized by Invitrogen with PPIA as the housekeeping gene (for primer sequences see Supplementary Table 2).
-
bioRxiv - Cancer Biology 2019Quote: ... anti-miR control or anti-miR-16 (Life Technologies, Carlsbad, CA, USA), and pre-microRNA negative control or pre-microRNA-16 (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... and miR-1 (Life Technologies, assay name: hsa-miR-1, cat# 4427975) following the manufacturer’s recommendations (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... qRT-PCR was performed in a multiplex format with 500 nM of ZIKV-specific primers and 250 nM of probes and a GAPDH-specific primer/probe set (4352339E, Applied Biosystems). The following ZIKV primer/probe sequences ...
-
bioRxiv - Microbiology 2019Quote: ... which was analyzed using a GAPDH-specific primer/probe set (ThermoFisher Scientific, Mm99999915_g1, #4331182).
-
bioRxiv - Microbiology 2019Quote: ... which was analyzed using a GAPDH-specific primer/probe set (ThermoFisher Scientific, Mm99999915_g1, #4331182). Arbitrary units were calculated as follows ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was normalized to the endogenous 18S primer-probe set (Thermo Fisher Cat #4319413E).
-
bioRxiv - Microbiology 2019Quote: ... Expression of TotM was measured using primer/probe sets for TotM (Dm02362087_s1 ThermoFisher 4351372) and normalized to RpL32 (Dm02151827_g1 (ThermoFisher 4331182) ...
-
bioRxiv - Cell Biology 2019Quote: ... Single strand cDNA was synthesized from the mRNA fraction of the total RNA by using Oligo dT primer and Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen, ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and antisense primer 3Vif (5-AGCTAGTGTCCATTCATTG-3) using a Superscript III single RT-PCR system with Platinum Taq DNA polymerase kit (Thermo Fisher Scientific) as per the manufacturers instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... using 0.5 µM forward (PCRp3) and reverse primer (RTp1) and the SuperScript III One-Step RT-PCR system with Platinum Taq DNA polymerase (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers and cDNA samples were validated by RT-PCR with the primers given in Table 1 and Taq DNA Polymerase (Life Technologies #10342020), using the following thermocycler program: 95°C for 2 min ...
-
bioRxiv - Immunology 2023Quote: The cDNA was synthesized by reverse transcriptase using oligo(dT)20 primer from 5 µg total RNA by the SuperScrip III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific). The NGS libraries for MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed with the respective human-specific sense and antisense primers and RT-SYBR™ Green PCR Master Mix (Applied Biosystems). Multiwell plates of 384 wells were run on a Viia 7 PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2022Quote: ... and miR-140 (Invitrogen) expression using the QuantiTect SYBR Green PCR Kit ...
-
bioRxiv - Microbiology 2022Quote: Specific RT-PCRs using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) were run to verify the presence of Clostridiaceae species (65) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was conducted using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) to amplify the extracted viral RNA (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was then performed with TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was carried out using TaqMan® One-Step RT-PCR master mix reagents kit (Applied Biosystems) with HCV primers (sense S66 [ACGCAGAAAGCGTCTAGCCAT] and anti-sense A165 [TACTCACCGGTTCCGCAGA] ...
-
bioRxiv - Microbiology 2023Quote: ... RT–PCR was performed using a Superscript III One-Step RT-PCR kit (Thermo Fisher Scientific, CA, USA) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: PCR primers and probes were designed with Primer Express version 3.0.1 (Thermo Fisher). All primers and probes were purchased from Eurofins.
-
bioRxiv - Genomics 2019Quote: ... and RT-PCR (Invitrogen, cat# 12574– 035) were performed for gene annotation and nucleotide sequencing correction ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR (Fast 7500 of Applied Biosystems) was performed using TB-Green™ Premix Ex Taq™ II ...
-
bioRxiv - Microbiology 2023Quote: ... with 10X RT PCR buffer (Applied Biosystems), 25mM MgCl2 (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... using the SuperScript RT-PCR kit (Invitrogen). They were cloned into the XhoI-AvrII site of the pEOE-attP-eGFP vector using In-Fusion cloning ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Developmental Biology 2023Quote: ... on the StepOnePlus RT PCR system (ThermoFisher). Data were analyzed using the Delta-Delta-CT method ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected with the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) for 5-6 days ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected with 300ng of Cav1.2-HA at DIV6 and 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher), and processed for immunostaining 13 days after ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were transfected at DIV 5 with 100ng of GFP alone or co-transfected with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher). After 5 days of expression ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected at DIV 5 with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) and 100ng of the Cacnb2 3’UTR luciferase reporters ...
-
bioRxiv - Pathology 2022Quote: ... RT) washed in 1X Perm buffer (eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set, ThermoFisher, #00-5523-00, 350g, 5min., RT) and incubated with anti-Ter119 (4µg/mL ...
-
bioRxiv - Plant Biology 2020Quote: Lines with defective stomatal responses to at least one stimulus were subjected to sequencing of “usual suspects” either by NGS-based sequencing of PCR amplicons obtained with the use of gene-specific primers (Supplementary Data Set 2) and Phusion DNA polymerase (ThermoFisher Scientific; ROUND 1 to 6), or whole-genome sequencing (ROUND 7 and 8) ...
-
bioRxiv - Microbiology 2022Quote: ... was used for the relative quantification of viral genomic copies using TaqPath and N1 primer-probe set in a qRT-PCR assay (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Pathology 2022Quote: ... Real-time RT-qPCR was performed using SYBR Green probe sets (Applied Biosystems, MA) and a Step One Plus thermal cycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: The sample sets: (i) CL1_DM1_H-(generated with SuperScript III RT, Invitrogen, Carlsbad, CA, USA) consisted of 3 DM1 samples extracted from DM1 myoblast cell lines (9886 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was set up with a SYBRTM Green qPCR SuperMix (Thermo Fisher Scientific) in quadruplicate reactions per primer or probe set ...
-
bioRxiv - Microbiology 2019Quote: ... PCR reactions were set up using Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific) and the following primer pair ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was then performed using AgPath RT-PCR (Life Technologies) kit on a QuantStudio(TM ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed using QuantStudio 3 PCR system (Applied Biosystems) or StepOnePlus Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2020Quote: ... and miR-9/9*-124 + TuD-miR-124 using TRIzol Reagent (Invitrogen, 15596026) in combination with RNeasy micro kit (Qiagen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Two different miR-146a mimics (Ambion/Thermo Pre-miR™ and miRVana mimic) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA knockdown was determined by RT-qPCR (Applied Biosystems 7500 Fast RT-PCR) using 2 independent primer sets for each transcript with Hprt1 and cyclophilin B (Ppib2 ...
-
bioRxiv - Cell Biology 2020Quote: ... using one step TaqMan RT enzyme and TaqMan RT-PCR Mix (Applied Biosystems). Relative quantification from triplicate amplifications were calculated by normalizing averaged threshold cycle (Ct ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR (AgPath-ID™ One-Step RT-PCR Reagents, Applied Biosystems™). The mean number of copies of extracellular viral RNA/μi of supernatant was then calculated (Applied biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by reverse transcription with RT primer (CCTTGGCACCCGAGAATTCCA) and SuperScript III (Invitrogen). PCR amplification was done with Q5 and primers with indexes (Forward ...
-
bioRxiv - Immunology 2022Quote: ... RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen) to synthesize first-strand cDNA ...