Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and subjected to PCR with primers (Forward primer: CCTGGATCTGAGGGAGCGA and reverse primer: AGGGCAGCGCGATTAGAAAG) using a Platinum™ Taq DNA High Fidelity polymerase (Invitrogen, Carlsbad, CA) or Platinum™ SuperFi II Green PCR Master Mix (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... MicroRNA PCR primers and probes were obtained from Thermo Fisher Scientific and are available upon request ...
-
bioRxiv - Microbiology 2021Quote: ... and the PCR primers were synthesized by Invitrogen (Shanghai, China). Overlapping-PCR based site-directed mutagenesis was employed to introducing point mutations of pyr2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Primers for qRT-PCR were obtained from Invitrogen (Vienna, Austria).
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR was performed using probe-labeled primers (Thermo Fisher) on the Quantstudio 3 (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR was performed using probe-labeled primers (Thermo Fisher) or using SYBR green on the Quantstudio 3 (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Universal PCR primer and 0.225ul 100x SybrGreen Dye (Invitrogen, S7563). The test PCR reaction was run in a (type of machine ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR primers were synthesized by Life Technologies (Carlsbad, CA, USA). Cas9 protein was purchased from ToolGen (Seoul ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers were diluted in PCR grade nuclease free water (Gibco) at a concentration of 100 µM ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was performed using multiplexed TaqMan primers (Applied Biosystems) for specific genes MEG9 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Amplification was performed on a 3×32 well Proflex PCR system (Applied Biosystems; Waltham, MA, USA). Reactions were amplified with a multi-step thermocycler protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-10 ng total RNA were reverse transcribed using the TaqMan miRNA Assay for rno-miR200b-3p (rno481286_mir, Cat# 4427975, Applied Biosystems, Foster City, CA) TaqMan Advanced miRNA cDNA Synthesis Kit (Cat# A28007 ...
-
bioRxiv - Microbiology 2021Quote: ... Multi-segment polymerase chain reaction (MS RT-PCR) was performed using SuperScript IV One-Step RT-PCR System with Platinum™ Taq High Fidelity DNA Polymerases (ThermoFisher, cat#12574-035) and influenza-specific universal set of primers(44 ...
-
bioRxiv - Microbiology 2020Quote: ... a 663-bp RT-PCR product was amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). A 20-μl reaction was assembled in PCR 8-tube strips through the addition of 10 μl 2× reaction mix ...
-
bioRxiv - Microbiology 2020Quote: 400-500 bp of RT-PCR product were synthesized and amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). 20μl reactions were assembled in PCR 8-tube strips through the addition of 10μl 2X reaction mix ...
-
bioRxiv - Developmental Biology 2021Quote: ... using Overlap Extension PCR primers and Phire Green Hot Start II PCR Master Mix (ThermoFisher). After agarose gel electrophoresis ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR (Q-PCR) was performed using standard Taqman universal mastermix and primers (Life Technologies). The primers (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... The primers used in the RT-qPCR assay were synthesized by Life Technologies (ThemoFisher Scientific) based on sequences retrieved from Primer Bank (http://pga.mgh.harvard.edu/primerbank/ ...
-
bioRxiv - Cell Biology 2019Quote: ... which was used to generate cDNA using random hexamer primers and SuperScript III RT (Invitrogen). qRT-PCR primer sequences are listed in Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... and with custom Multiplex RT Primer pool in a SimpliAmp™ Thermal Cycler (Applied Biosystems), according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... and cDNA was prepared using Superscript II RT and oligo(dT)n primers (Life technologies). qRT-PCR was performed on a StepOnePlusRT-PCRsystem(AppliedBiosystems ...
-
bioRxiv - Genetics 2020Quote: ... containing a gene-specific RT primer and a TaqMan MicroRNA Reverse Transcription kit (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNAs were synthesized using specific reverse primers and MMLV RT (Revertaid ™ Thermo Scientific) at 42°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNAs were synthesized using specific reverse primers and MMLV RT (Revertaid TM Thermo Scientific) at 42°C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using an ABI7500 Real-Time PCR System (Thermo Fisher Scientific, USA) and TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Microbiology 2022Quote: All cDNA fragments generated by PCR/RT-PCR were purified using a GeneJET PCR Purification kit (Thermo Scientific) following the manufacturer’s instructions prior to use in TAR ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR (qRT-PCR) assays were run in a ViiA7TM Fast Real-Time PCR System (Applied Biosystems) in MicroAmp® Optical 384-Well Reaction Plate (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: PCR was performed on RT+ and RT-cDNA reactions using Amplitaq Gold DNA Polymerase (Thermo Fisher Scientific) and primer pairs corresponding to each newly identified VZV transcript (Table S5) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions of quantitative real-time PCR (qRT-PCR) were set up using POWER SYBR green Master-mix (Invitrogen) according to manufacturer’s instructions and analyzed on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR reactions were set up as follows: 25 μl Platinum II hot start green PCR master mix (Invitrogen), 1 μl each primer (10 μM) ...
-
bioRxiv - Genomics 2019Quote: ... PCR was performed using gene-specific primer sets (http://pga.mgh.harvard.edu/primerbank/) and Taqman chemistry (Universal Master Mix II with UNG, Life Technologies) on a ViiA 7 Real-Time PCR System (Life Technologies) ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced in both directions with the original set of primers on a 3730XL DNA Analyzer (Applied Biosystems) at the Sanger Sequencing Facility of the Centre for Applied Genomics ...
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... TaqMan pre-designed primer-probe sets used for the evaluation of specific gene expression (Applied Biosystems, Waltham, MA). TaqMan primer-probe sets and subsequent assay ID include 18S rRNA ...
-
bioRxiv - Genetics 2020Quote: ... The threshold cycle (CT) for each primer set was automatically determined by the StepOne Software 2.1 (Applied Biosystems). Relative fold changes of gene expression were calculated by using the 2−△△Ct method ...
-
bioRxiv - Microbiology 2021Quote: ... and a set of primers and probes to detect kdr alleles (Supplementary Table S3) customized by Thermo Fisher Inc ...
-
bioRxiv - Genomics 2022Quote: ... 19.8 μL RevT primer set and 39.6 μL Maxima H Minus Reverse Transcriptase (200 U/μL, Thermo Fisher). 80 μL of the mix were added to each well ...
-
bioRxiv - Pathology 2021Quote: ... OpenArray chip containing the pre-coated primers for 607 targets was read on 12 K Flex RT-PCR machine (Thermo Fisher Scientific, Life Technologies Corporation, Grand Island, New York). Data analysis was performed through the online available Expression suit v 1.3 software (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR was performed using the TaqMan system (Applied Biosystems) in a 384-well format ...
-
bioRxiv - Immunology 2020Quote: ... in a ViiATM-7 RT-PCR system (Thermo Fisher Scientific). Primer sequences are available upon request ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR was performed using M-MLV reverse transcriptase (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... in a Viia 7 RT-PCR machine from Applied Biosystems. All experiments were performed with least three biological replicates collected from different days ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-PCR was performed using SuperScript III (Invitrogen), Platinum Taq HiFi polymerase (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: The SuperScript First-strand Synthesis System for RT-PCR (Invitrogen) was used to synthesize cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized using the ThermoScript RT-PCR System (Invitrogen) from 1mg of total RNA using Random Primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using SYBR Green (Applied Biosystems) method in a 384-well format using the ABI Prism 7900HT (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized by using RT-PCR kit (Life Technologies). The real time PCR was performed by using SYBR green super mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: ... The quantitative RT-PCR analysis was performed by StepOneTM (ThermoFisher) and KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... Semiquantitative RT-PCR was performed using DreamTaq (Thermo Fisher Scientific) with 25 to 30 amplification cycles followed by electrophoresis on 2% agarose gel stained with ethidium bromide ...