Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 2% FCS (ThermoFisher), and 50 μg/mL gentamicin (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... 2% FCS (Gibco), 25 mM HEPES (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit anti-SARS-CoV nucleocapsid polyclonal antibody (PA1-41098, Thermo Scientific, Rockford, IL) diluted 1:2,000 in blocking buffer was allowed to bind overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... S1 proteins were pre-biotinylated using EZ-Link NHS-PEG4-Biotin (ThermoFisher Scientific). Following 20 minutes of pre-hydration of SA biosensors and 1 minute of sensor check ...
-
bioRxiv - Immunology 2021Quote: Cells exposed to SARS-CoV-2 pseudovirus were lysed and mRNA was isolated with the mRNA Catcher™ PLUS Purification Kit (ThermoFisher). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2-TCR mRNA was transcribed in vitro using the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (ThermoFisher Scientitic) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... washed twice with PBS and stained with anti-SARS-CoV-2 (1A9; Biozol GTX-GTX632604) anti-MUC5AC (clone 45M1; MA1-21907, Thermo Scientific) and anti-alpha-tubulin (MA1-8007 ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the Express one step RT-qPCR Universal kit (ThermoFisher Scientific) using 3.5µL of RNA and 6.5µL of RT-qPCR mix that contains 250nmol of each primer and 75nmol of probe ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were measured by quantitative PCR using TaqMan Fast Universal PCR Master Mix (Thermo Fisher: Cat# 4352042) on the Applied Biosystems 7500 Fast Dx Real-Time PCR System ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 2.5 μg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes 45 using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: The SARS-CoV-2 Omicron HexaPro S protein gene was synthesized and inserted into pcDNA3.1 (GeneArt Gene Synthesis, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA levels were quantified by quantitative reverse-transcriptase PCR (qRT-PCR) specific for the SARS-CoV-2 E gene (23) using TaqMan Fast 1-Step Master Mix (Applied Biosystems) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 2.5 μg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes(Rihn et al., 2021) using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Co-cultures were infected with 1x104 PFU of SARS-CoV-2 in 100 µl of OptiMEM (Thermo Fisher Scientific, Waltham, MA) added to the apical surface ...
-
bioRxiv - Microbiology 2022Quote: ... 5μg of the infectious clone and 100ng of a SARS-CoV-2 WA-1 nucleoprotein expression plasmid were diluted in 100μL of OptiMEM (Gibco, Waltham, MA). 3μL of TransIT-2020 (Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Immunology 2020Quote: The Fab fragments for anti-SARS-CoV-2 antibodies ION_300 and ION_360 and SARS-CoV-2 receptor binding domain (RBD) were expressed in Expi293F™ cells (Thermo Fisher, A14527). The antibody:RBD complexes were mixed and co-purified by size exclusion chromatography in 20 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... a codon optimized cDNA sequence for the ORF of SARS-CoV-2 N (NCBI reference sequence number: NC_045512) was cloned into the pEGFP-C1 (by GeneArt-Thermo Fisher Scientific). Once cloned ...
-
bioRxiv - Immunology 2020Quote: Human peripheral blood mononuclear cells (PBMCs) from SARS-CoV-2 convalescent donors were stained with Live/Dead Fixable Aqua (Invitrogen; Thermo Scientific) in 100 μL final volume diluted 1:500 at room temperature (RT) ...
-
bioRxiv - Microbiology 2021Quote: A mammalian expression plasmid expressing the coding sequence of SARS-Cov-2 Nsp4-Nsp5 in a pCDNA3.1 backbone was synthesized (GeneArt™ Gene synthesis, ThermoFisher, USA). HEK 293T cells in a 6 well plate were transfected with polyethylenimine (PEI ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA coding for SARS CoV-2 Nsp1 1-180 Nsp2 1-19 8His was synthesised by GeneArt (Thermo Fisher Scientific) adding NcoI and NotI sites at the 5’ and 3’ ends ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: A codon-optimized gene encoding for SARS-CoV-2 (331 to 528 amino acids, QIS60558.1) was expressed in Expi293 cells (Thermo Fisher Scientific) with human serum albumin secretion signal sequence and fusion tags (6xHistidine tag ...
-
bioRxiv - Immunology 2022Quote: ... 30 μl of SARS-CoV-2 S-5P or 6P at 5 ng/µl were plated onto 384-well Nunc Maxisorp (Thermo Fisher) plates in PBS and sealed overnight at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... were transfected in suspension with 4.0 µg/well of SARS-CoV-2/mCherry-Nluc BAC plasmid using Lipofectamine 2000 (Thermo Fisher Scientific). Transfection media was changed to post-infection media (DMEM containing 2% FBS and 1% PSG ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant poly-histidine tagged ectodomains of the SARS-CoV-2 S proteins (614D and 614G) were expressed in human Expi293F cells using the Expi293 Expression System (ThermoFisher Scientific) and purified using HisTrap FF column (GE Life Sciences)18 ...
-
bioRxiv - Microbiology 2021Quote: ... 11 cDNA fragments with 70 bp end-terminal overlaps which spanned the entire SARS-CoV-2 isolate Wuhan-Hu-1 genome (GenBank accession: NC_045512) were produced by GeneArt™ synthesis (Invitrogen™, ThermoFisher) as inserts in sequence verified ...
-
bioRxiv - Immunology 2020Quote: ... SARS-COV-2 Spike-specific F(ab’)2 was isolated by affinity chromatography using recombinant antigen (1 mg SARS-CoV-2 S-2P or RBD) coupled to 0.05 mg dry NHS-activated agarose resin (Thermo Fisher Scientific) as follows ...
-
bioRxiv - Genomics 2021Quote: ... standard PCR-based detection of SARS-CoV-2 was initiated by extraction of viral RNA from nasopharyngeal (NP) swabs (KingFisher™ Flex Magnetic Particle Processor, ThermoFisher). The viral RNA was analyzed ...
-
bioRxiv - Immunology 2021Quote: Monoclonal antibodies or recombinant SARS-CoV-2 RBD + SBD1 or NTD proteins were transfected in FreeStyle 293F suspension cells (Life Technologies) using PEIMAX transfection reagent (Polysciences) ...
-
bioRxiv - Immunology 2020Quote: Human peripheral blood mononuclear cells (PBMCs) from SARS-CoV-2 convalescent donors were stained with Live/Dead Fixable Aqua (Invitrogen; Thermo Scientific) in 100 μL final volume diluted 1:500 at room temperature (RT) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse:CCATCCAATCGGTAGTAGCG) or the SARS-CoV-2 N gene (forward: TTACAAACATTGGCCGCAAA, reverse: GCGCGACATTCCGAAGAA) and Power SYBR Green PCR Master Mix (Applied Biosystems) were used to amplify cellular RNA and viral RNA by QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: Fifty microliters containing 3.5 x 106 PFU/ml SARS-CoV-2 viral stock was placed on one well of a 4-well chambered glass slide (Nunc, Sigma) (Fig 2) ...
-
bioRxiv - Microbiology 2022Quote: ... Calu3 monolayers were washed once with MEM-Eagles medium (MEM) without FBS and infected with SARS-CoV-2 in the presence of 20 μg per ml TPCK trypsin (Thermo scientific). Plates were incubated for 1 h at 37°C to allow viral adsorption ...
-
bioRxiv - Microbiology 2022Quote: Copies of the SARS-CoV-2 N gene (genomic) were measured by qRT-PCR TaqMan Fast Virus 1-step assay (Applied Biosystems). SARS-CoV-2 specific primers and probes from the 2019-nCoV RUO Assay kit (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: Copies of SARS-CoV-2 E gene (subgenomic) were measured by qRT-PCR with TaqMan Fast Virus 1-step assay (Thermo Fisher). SARS-CoV-2 specific primers and probes sgLeadSARSCoV2-F 5’-CGATCTCTTGTAGATCTGTTCTC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 2.5 µg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes [65] using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The Z-scores for reactivity of SARS CoV-2 proteins to each human protein was determined by using ProtoArray Prospector v 5.2 software (Invitrogen, Thermo Fisher).
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2/UT-NCGM02/Human/2020 (Wuhan strain) was propagated in VeroE6/TMPRSS2 cells in VP-SFM (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... quantification of ADCP was performed by covalently binding SARS-CoV-2 NTD and NTD_ADEm3 to NeutrAvidin fluorescent beads (ThermoFisher, Waltham, MA). Immune complexes were formed by incubation with serially diluted (2 fold ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 50 μL of a 1:4,000 dilution of rabbit anti-SARS-CoV-2 nucleocapsid antibody (Invitrogen, Waltham, MA, Cat# MA536086) in blocking buffer was added and incubated for 2 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... or pCDNA SARS-CoV-2 ORF7a-V5/His (WT/H47Y; 0.75 μg) or empty vector using Lipofectamine 3000 (Thermo Fisher Scientific) per manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2023Quote: ... 5μg of the infectious clone and 100ng of a SARS-CoV-2 WA-1 nucleoprotein expression plasmid were diluted in 100μL of OptiMEM (Gibco, Waltham, MA). 3μL of TransIT-2020 (Mirus Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 cells were used as host cells to transfect the SARS-CoV-2 FSE dual luciferase reporter plasmid using Lipofectamine 2000 transfection reagent (ThermoFisher Scientific). The -1 PRF efficiency was assayed in cultured HEK293 as described previously (Kelly et al ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were probed with rabbit-anti-SARS spike (Invitrogen, PA1-411-1165, 0.5ug/ml), rabbit-anti-Orf6 (Abnova ...
-
bioRxiv - Bioengineering 2021Quote: ... HEK293 cells were first biotinylated using EZ-Link Sulfo-NHS-SS-Biotin (ThermoFisher) following the manufacturer’s specified procedure ...
-
bioRxiv - Microbiology 2021Quote: ... pCG1-SARS-2-SdC19 or pCG1-SARS-2-SdC19-H2 using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from mock and SARS-CoV-2 infected proximal airway ALI and alveolar organoid cultures lysed in Trizol (Thermo Fisher Scientific) using the chloroform-iso-propanol-ethanol method ...
-
bioRxiv - Immunology 2021Quote: ... and searched against the UniProt Human protein database and RefSeq SARS-CoV-2 protein database using Sequest HT through Proteome Discoverer (Version 2.2) (Thermo Scientific, Bremen, Germany). Precursor and fragment mass tolerance were set to 10 ppm and 0.02 Da ...
-
bioRxiv - Microbiology 2020Quote: The melting profiles were obtained incubating 10 ng of SARS-CoV-2 RNA with 10 or 100nM of DCV and Sybergreen (1x) (Thermo Fisher Scientific) in an StepOne™ Real-Time PCR System (Thermo Fisher Scientific ...