Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The construct with a N-terminal 8xHis-TwinStrep-GFP-tag were expressed in GripTite HEK293 MSR cells (Thermo Fisher) in black 96 well plates with transparent bottoms ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant hACE2-Fc protein was biotinylated using the EZ-Link sulfo-nhs-biotin kit (ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Tissues were incubated with mouse anti-P-glycoprotein C219 antibody at 3.6μg/mL (Glycoprotein Monoclonal Antibody C219, Cat. No MA1-26528, Invitrogen) overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... A glycoprotein ladder (Candy Cane ladder; Invitrogen) served as positive control ...
-
bioRxiv - Microbiology 2024Quote: ... along with a CandyCane glycoprotein ladder (Thermofisher). We additionally loaded the same two B ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP-linked F(ab’)2 fragment (from sheep, Thermo Fisher Scientific NA9310) All antibodies were used within the range of suggested dilution ...
-
bioRxiv - Immunology 2021Quote: ... Cells grown to a density of 3 million cells per mL were transfected using pCMV::SARS-CoV-2_S_NTD derivative mutants with the ExpiFectamine™ 293 Transfection Kit (ThermoFisher Scientific) with and cultivated for five days at which point the supernatant was harvested ...
-
bioRxiv - Biochemistry 2023Quote: ... and SARS-CoV-1 HexaPro S) at 3 µg/mL were placed into 384-well Nunc Maxisorp plates (ThermoFisher, 464718) in 1x TBS and incubated for 1 hour at 37°C followed by slap drying and blocking with 80 µL of Casein for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg of plasmid encoding SARS-CoV2 spike (D614) with C-terminal 18 amino acid deletion using Lipofectamine LTX Plus reagent (Invitrogen, USA) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... washed with 2 % FCS/PBS and then re-suspended in 2 % FCS/PBS containing 7-amino actinomycin (7-AAD, Invitrogen) at a concentration of 5 µg/ml ...
-
bioRxiv - Immunology 2022Quote: ... the DNA fragments encoding the spikes of MERS-CoV and sarbecoviruses without the ER retrieval signal were codon-optimized and synthesized at GeneArt (Life Technologies). The spike encoding genes of Pang17 (residues 1-1249 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was conducted with equal amounts of resultant cDNAs and indicated primers (Table S1) using Platinum Tag DNA Polymerase High Fidelity (Invitrogen) under thermal cycling for 2 min at 94°C followed by 25 cycles of 20 s at 94°C ...
-
bioRxiv - Biochemistry 2021Quote: ... S1 subunit and the S protein (InVivo Biotech) were biotinylated using 10 molar excess of NHS-LC-Biotin (Thermo Scientific). Immunoassay plates were coated with 2.5 μg/ml recombinant angiotensin converting enzyme-2 (ACE2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HBSS with 2 % FCS (Gibco, cat no. 10500064) was used for the whole procedure ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 2% FCS (ThermoFisher, cat no A4766801) containing doubling dilutions of the various compounds at the stated concentrations ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% 0.2µm filtered FCS (Gibco, 10500), 0.1M HEPES (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... fused to a C-terminal trimeric GCN4 (tGNC4) zipper tag via a 5XGGS linker region was secreted from suspension HEK293 FreeStyle cells (ThermoFisher) in the presence of 20 μM kifunensine (Dextra ...
-
bioRxiv - Microbiology 2020Quote: ... RBD-Fc was biotinylated with EZ‐link sulfo‐NHS‐LC‐biotin (Thermo Fisher Scientific, Waltham, MA) (RBD-Fc-Bio) ...
-
bioRxiv - Immunology 2024Quote: ... hDPP4-Fc and G2 were biotinylated using EZ-Link™ Sulfo-NHS-LC-Biotin (Thermo Scientific) and 80% maximum binding concentrations against S-2P were determined with biotinylated proteins (hDPP4-Fc-biot and G2-biot) ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA Tag antibody for SaCas9 protein (2-2.2.14, Thermofisher), rabbit anti-GFP (A11122 ...
-
bioRxiv - Microbiology 2022Quote: ... or Mouse-anti-HA tag (2-2.2.14) antibody (Invitrogen) (for HA-tagged vRNP complex pulldown experiment ...
-
bioRxiv - Cell Biology 2021Quote: HEK293T (ATCC® CRL-3216™) and S1/S2 DKO HEK293 cells were maintained in cell culture in 1X DMEM (41965-039, Thermo Fisher Scientific) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: Proteins with C-terminal biotin tags were attached to streptavidin-coated dynabeads (Dynabead M-280 Streptavidin, Invitrogen) following standard procedures ...
-
bioRxiv - Physiology 2022Quote: ... sheep (Invitrogen, A21436) and mouse (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... ERCC spike-in control (Thermo Fisher, mix 1, dilution 1:2 millions) was added to each well (except for the negative control) ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant spike protein and ACE2 was conjugated with EZ-Link™ Sulfo-NHS-Biotin (1:3 molar ratio; Thermo Fisher) in Dulbecco’s PBS at room temperature for 30 min ...
-
bioRxiv - Systems Biology 2020Quote: ... and a second part was stained and analysed for glycoproteins using the Pro-Q 488 Emerald Glycoprotein staining kit (P33375, Thermo/Invitrogen), according to the manufacturers protocol ...
-
bioRxiv - Pathology 2022Quote: ... GTGATGCTGCTCTTGCTTTG and SARS-CoV-2_N-R1: GTGACAGTTTGGCCTTGTTG) and Power SYBR Green PCR MasterMix as per the manufacturer’s protocol (Applied Biosystems, CA, USA) 63 ...
-
bioRxiv - Immunology 2023Quote: ... GTGATGCTGCTCTTGCTTTG and SARS-CoV-2_N-R1: GTGACAGTTTGGCCTTGTTG) and Power SYBR Green PCR MasterMix as per the manufacturer’s protocol (Applied Biosystems, CA, USA). The SARS-CoV-2 N gene-specific primers were used to amplify a 97 bp product by conventional PCR and this was purified by the Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 1.5 ug of WT or mutant SARS-CoV-1 S plasmid using polyethylenimine (PEI) (Thermo Fisher Scientific). Cells were transfected for 24 hours ...
-
bioRxiv - Molecular Biology 2022Quote: The synthetic sequence of the 3 x FLAG tag (Table S1) was inserted between the KpnI and NotI sites of the vector pcDNA5/FRT/TO (ThermoFisher Scientific) to prepare a DNA construct for N-terminal FLAG fusions ...
-
bioRxiv - Biophysics 2022Quote: The full-length CcdA and CcdA peptides of different lengths (Table S1) were biotinylated with EZ-linkTM NHS-Biotin (ThermoFisher Scientific) as per the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... from wild type tobacco plastome sequence flanking NarI restriction site were amplified by PCR using primers described in Table S1 and labeled with Biotin DecaLabel DNA Labeling Kit (Thermo Scientific). Therefore ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 T-Rex (referred to as HEK293, cat.no. R71007, Invitrogen) and NIH3T3 cells were grown in DMEM Glutamax® (Thermo Fisher Scientific ...
-
Modified N-linked glycosylation status predicts trafficking defective human Piezo1 channel mutationsbioRxiv - Biophysics 2020Quote: ... HEK293S GnT1-/- or HEK293 cells (ThermoFisher Scientific, Cat. No. R78007) using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Human wild type ABCG2 or ABCG2 R184A containing an N-terminal Flag-tag was expressed in HEK293-EBNA (Thermo Fisher Scientific) cells as previously described19 ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells (Invitrogen) were grown in DMEM (1g/L glucose ...
-
bioRxiv - Synthetic Biology 2022Quote: HEK293 cells (ThermoFisher; further authenticated by assessing cell morphology and growth rate ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant Fc linked DR5 variants were biotinylated using EZ-Link Sulfo-NHS-SS-Biotin (Thermo Scientific 21331) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... A capture antibody solution was prepared by adding 0.02 μg of biotin anti-FC (Thermo Fisher, A18821) per 1 mL of washing buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... with 10% FCS and 2 mM L-glutamine (Gibco). Wild type and FEN1−/− U2OS cells were grown under 3 % oxygen levels ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FCS and 2% B-27 (Gibco) and maintained at 5% CO2 and 37°C in humidified incubators ...
-
bioRxiv - Immunology 2020Quote: ... spike protein was expressed by transiently transfecting plasmid encoding the HexaPro spike variant2 containing substitutions S383C and D985C3 with a C-terminal TwinStrep tag into FreeStyle 293-F cells (Thermo Fisher) using polyethyleneimine ...
-
bioRxiv - Cancer Biology 2021Quote: ... The FAP primary antibody was detected with a secondary biotin-conjugated anti-goat/sheep mouse IgG and 1:1000 Streptavidin PE-Cy7 (Thermo Fisher Scientific). EdU was detected using the Click-IT Plus Flow Cytometry Assay with AlexaFluor® 488 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and HA tag (2-2.2.14; ThermoFisher Scientific 26183, 1:10,000), used with goat anti-mouse IgG AlexaFluor®568 (ThermoFisher Scientific A-11004 ...
-
bioRxiv - Microbiology 2023Quote: ... and anti-HA tag (clone 2-2.2.14, Thermo Fisher Scientific), anti-ADAM17 (rabbit polyclonal ...
-
bioRxiv - Microbiology 2023Quote: ... and anti-HA tag (clone 2-2.2.14, Thermo Fisher Scientific). Secondary antibodies included Alexa Fluor 488-conjugated anti-rabbit IgG (polyclonal ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 µ l of MBD2-Biotin (Thermo Fisher Scientific, A11148) was incubated with 8 µ l of Cy3 labeled cfDNA fragments for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified DNA was debranched by adding 10 μL of 5X S1 nuclease buffer and 2 μL S1 nuclease (200 U; Thermo Fisher Scientific Inc., Waltham, MA), mixed and incubated at 25°C for 30 minutes and then 70°C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... and 1.11 µg pCG1-SARS-2-SdFdC19 using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instruction ...