Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Cell Biology 2024Quote: ... The siRNA oligonucleotide targeting RIF1 sequence (Invitrogen; Sense: 5’-GAAUGAGCCCCUAGGGAAATT-3’) 138 was used ...
-
bioRxiv - Cell Biology 2022Quote: ... and resuspended in 5% formic acid and 5% acetonitrile for analysis by LC/MS-MS on an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific) coupled to a Proxeon EASY-nLC II liquid chromatography (LC ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2022Quote: ... mixed with an equal volume of 5:1 acid phenol: chloroform (ThermoFisher Scientific), and centrifuged again ...
-
bioRxiv - Bioengineering 2024Quote: ... Palmitic acid (Palm) and 5(6)- carboxyfluorescein (FAM) were acquired from Acros Organics. Piperidine ...
-
bioRxiv - Cell Biology 2024Quote: ... 12 alternating fractions were resuspended in 2% formic acid/5% acetonitrile and subsequently injected for analysis on an Orbitrap Eclipse Tribrid (Thermo Fisher Scientific). For the yeast cell PISA ...
-
bioRxiv - Immunology 2024Quote: ... Brain areas were individually Dounce homogenized in 6ml ice cold FACS buffer (5% Bovine Serum Albumin Proteins, 2 mM Ethylenediaminetetraacetic Acid (EDTA) in PBS (Gibco 14190-144), sterile filtered ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then washed 3 x 5 min in PBS and incubated for 5 min in DAPI (Invitrogen, cat# D1306) 1:1000 in PBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1.5 µg of total RNA of each sex were subjected to 5’ and 3’ RACE with a GeneRacer kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... A 300 μL solution of 5% formic acid and 0.2% trifluoroacetic acid (TFA) R2 50 μm Poros (Applied Biosystems) beads slurry in water was added to the gel pieces before returning the samples to the shaker for an additional three hours at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 200µL 5-Ethynyl-2’-deoxyuridine (EdU, Molecular probes; 3g/L) was injected intraperitoneally in pregnant females 2 hours before embryo isolation.
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Cell Biology 2020Quote: ... For 5-ethynyl-2’-deoxyuridine (EdU) incorporation assays (Life Technologies), 10μM EdU was included in culture for two hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, cat. #E10415) was diluted 2.5 mg/ mL in sterile PBS and injected intraperitoneally on days 3 and 4 post-injury at a dose of 10 μL/ g body weight ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific, Waltham, MA) was either injected i.p ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 2 - 5 μg/ml Puromycin Dihydrochloride (Thermo Fisher, # A1113803) until all negative control cells were dead ...
-
bioRxiv - Microbiology 2022Quote: ... or 0.1 mM 5-ethynyl-2’-deoxyuridine (EdU; Life Technologies) was added for the time indicated in the text.
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific, Barcelona, Spain) was added for 48h ...
-
bioRxiv - Immunology 2021Quote: ... 5 μM of 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Invitrogen) probe was added to each neutrophil subtype and incubated in the dark for 15 min ...
-
bioRxiv - Biophysics 2020Quote: ... while GRN-5 was expressed in Origami 2 DE3 (Invitrogen) as fusion constructs with a thioredoxin-A and hexa-histidine tag (TrxA-Hisx6-GRN) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml of bovine collagen I (5 mg/ml) (Gibco), and 6.67 ml serum starvation medium were mixed on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... For pulsed EdU (5-ethynyl-2’-desoxyuridine) (Thermo Fisher Scientific) incorporation ...