Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 1% penicillin/streptomycin and 5 mL nonessential amino acids (NEAA, Gibco). Experiments were performed on days 9 to 10 of differentiation ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ml non-essential amino acids (NEAA) (1 %) (Gibco, 11140-035), 0.5 ml β-mercaptoethanol (50 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL MEM non-essential amino acids (NEAA, Gibco, #.11140-050), 5 mL sodium pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mL 100X non-essential amino acids (Gibco Cat 11140-050), 5 mL 100X GlutaMAX (Gibco Cat 35050-061) ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples (5 μl aliquot) were normalized to 2-5 nM with Nuclease-free Water (Ambion), then 2 μl from each sample within one 96-index set was pooled to a total of 192 μl at 2-5 nM concentration ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5×10-5 M hydrocortisone hemisuccinate (Upjohn, Serb) and 2 mM glutamine (Gibco, 25030-024). Progenitors (D4 ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Cell Biology 2024Quote: ... The same test was done in parallel to assess the cell viability using MTT at 5 ug/mL (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Invitrogen). Sixteen sites per well were acquired using a 20x Olympus objective plan fluorite NA 0.45 (1320517 ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides were resuspended in 2% acetonitrile in 0.1% formic acid and loaded at 5 μL/minute onto a PepMap C18 trap column (Thermo Scientific; 5 μm 100 Å particle size ...
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... loaded with 5 μM Rhod-2,am (ThermoFisher) in a zinc-containing HEPES-based salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2021Quote: ... EdU (5-ethynyl-2’-deoxyuridine, Invitrogen, cat# A10044) was dissolved in PBS at 0.5 µg/µl and injected intraperitoneally into mice at 5 µg/g body weight 24 h before harvesting ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’– deoxyuridine (27) (Invitrogen, Cat# A10044) was administered through drinking water (0.5mg/ml) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3μM EdU (5-ethynyl-2′-deoxyuridine, A10044 Invitrogen) was added to the culture for 48h in the following time window ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mL N-2 Supplement (Thermo Fisher 17502048). Long-Term Glioma Organoid Medium and Short-Term Glioma Organoid Medium stocks were used up to 2 months and 1 week after preparation ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of 5 mM DSSO (Thermo Fisher) in 10% DMSO ...
-
bioRxiv - Neuroscience 2023Quote: ... we add EdU (5-ethynyl-2’-deoxyuridine; Invitrogen), a direct measure of de novo DNA synthesis ...
-
bioRxiv - Cancer Biology 2023Quote: ... EdU (5-ethynyl-2’-deoxyuridine) was from Invitrogen. Formaldehyde and paraformaldehyde were obtained from Sigma and Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2023Quote: EdU (5-Ethynyl-2′-deoxyuridine, Life technologies A10044) was administered as previously described 63 ...
-
bioRxiv - Microbiology 2022Quote: ... 5-diphenyl-2-H-tetrazolium bromide) assay (Invitrogen) was performed to follow the proliferation of KO-SFPQ or siSFPQ HCT116 cells compared to WT or siCtrl HCT116 cells respectively ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μl 5× first strand buffer (ThermoFisher Scientific), 1 μl 10 μM reverse primer (miR_tail_RT ...
-
bioRxiv - Microbiology 2023Quote: ... every 2–5 days in complete media (Gibco): growth factor-supplemented DMEM/F12 with high glucose media with 10% FCS ...
-
bioRxiv - Neuroscience 2023Quote: ... consisting of 5% 2-mercaptoethanol (ThermoFisher Scientific; USA). 40ug of each sample was denatured at 95°C for 5 minutes and loaded in 4–20% Mini-PROTEAN® TGX™ Precast protein gels (Bio-Rad ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 2-5 μg/ml Blasticidin S (Life Technologies), or 0.9 μM DSM1 (BEI Resources ...
-
bioRxiv - Immunology 2024Quote: ... anti-ɑ-tubulin (B-5-1-2; Invitrogen), Alexa Fluor 488 anti-acetylated tubulin (6-11B-1 ...
-
bioRxiv - Cell Biology 2024Quote: ... BrdU (5-bromo-2’-deoxyuridine) (11594167, Invitrogen™) was administered 6h later i.p ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...