Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 5 μL was loaded into a 2% agarose gel (Thermo Fisher) in 1X TAE buffer (MP Biomedicals) ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryos were incubated with 400 µM 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen)/DMSO in fish water for 1 hour at 28°C ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were incubation with 10uM EdU (5-ethynyl-2’ -deoxyuridine) (Invitrogen, C10424) for 48hours together with either recombinant-mouse TIMP1 protein (1µg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... containing 2% fetal bovine serum and 5 mM HEPES buffer (Life Technologies). For live imaging experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 × 105 cells were resuspended in 2 μL HBSS (Gibco, Cat# 14170088) and stored on ice ...
-
bioRxiv - Immunology 2023Quote: ... cells were stained with 2 or 5 μM CellTrace Violet (Invitrogen, #C34557). For ex vivo reculture experiments ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of 5 X SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 μL of the 20 mM ligand solution or the equivalent amount of buffer in the ligand-free control ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were pulsed with 10μM EdU (5-ethynyl-2-deoxyuridine, Invitrogen A10044) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: To detect DNA synthesis EdU (5-ethynyl-2′-deoxyuridine; 10 μM, Invitrogen) was added to the medium and incubated for 24 h from days 8 to 9 post-treatment ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 5 X SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 µl of the resuspended array compounds or the equivalent amount of buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 nmoles of RNA were mixed with 5 µg yeast tRNA (Invitrogen) and SELEX buffer (SB ...
-
bioRxiv - Cell Biology 2024Quote: ... with EdU (5-ethynyl-2’-deoxyuridine) (A10044, Invitrogen™/ Thermo Fisher Scientific) as a DPBS solution 200ug/20g body weight ...
-
bioRxiv - Cell Biology 2024Quote: ... with EdU (5-ethynyl-2’-deoxyuridine) (A10044, Invitrogen™/ Thermo Fisher Scientific) as a DPBS solution 200ug/20g body weight ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated upon shaking at the growth temperature for 5 min with following concentrations: FM 5-95 (2 µg/ml; Thermo Fisher Scientific), DiSC3(5 ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA sequences targeting CD33 exon 2 were 5’-TCCATAGCCAGGGCCCCTGT and 5’-GCATGTGACAGGTGAGGCAC.25 U937 cells were washed three times in PBS (Gibco 10010-023) and resuspended in complete Nucleofector Kit C (Lonza Biosciences VCA-1004 ...
-
bioRxiv - Pathology 2020Quote: ... Aliquots of 15 μL per sample were loaded at a rate of 5 μL/min onto a trap column (100 μm × 2 cm, PepMap nanoViper C18 column, 5 μm, 100 Å, Thermo Scientific) which was equilibrated with 98% Buffer A ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids (after 1 week of culture) were incubated (37°C, 5% CO2, 1 h) with 10 µM EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher Scientific), a nucleoside analog of thymidine incorporated into DNA during active DNA synthesis ...
-
bioRxiv - Biophysics 2024Quote: ... for 2 hours at 37°C (with 5% CO2 and humidity) before indicator loading with 5 µM Fluo-4 AM (Invitrogen, Waltham, MA) with 1% PowerLoad Concentrate ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Cell Biology 2022Quote: ... Itgb1 (forward 5’-ATGCCAAATCTTGCGGAG AAT, reverse 5’-TTTGCTGCGATTGGTGACATT), and GAPDH (forward 5’– GGTCATCCATGACAACTT, reverse 5’–GGGGCCATCCACAGTCTT) are designed and synthesized by Invitrogen (Shanghai, China).
-
bioRxiv - Bioengineering 2023Quote: ... stained with 5 ng/mL dichlorotriazinylaminofluorescein (5-DTAF, Invitrogen), and mounted in custom grips at a 10 mm gauge length ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% CO2 and 5% O2 in RPMI 1640 (Gibco) with 15% FBS (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... ITS (5 μg/ml insulin, 5 μg/ml transferrin, and 5 ng/ml sodium selenite, Gibco), and antibiotics (100 U/ml penicillin and 0.1 mg/ml streptomycin) ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... x 5 mm 5 μm 100 Å and an Acclaim PepMap RSLC 75 μm x 50 cm 2 μm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Dionex) ...
-
bioRxiv - Microbiology 2024Quote: Total RNA extracted from BoDV-2-infected Vero cells was ligated with either 5’ adaptor oligoRNA (5’-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA (Thermo Fisher Scientific, USA; #L150201)) or 3’ adaptor oligoRNA (5’-GAAGAGAAGGUGGAAAUGGCGUUUUGG ...
-
bioRxiv - Biochemistry 2024Quote: ... x 5 mm 5 μm 100 Å and an Acclaim PepMap RSLC 75 μm x 50 cm 2 μm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... nucleic acid staining was performed by vaccum-infiltrating a 5 μM of Sytox Orange (Thermo Fisher; S11368) solution ...