Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: 0.63 mmole (1 equivalent) of the nucleoside-5’-monophosphate free acid (Santa Cruz Biotechnology or ACROS Organics) and 5 equivalents of 2-aminoimidazole hydrochloride (Combi-Blocks ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted 5% volume to volume in paraffin oil (Fluka Analytical, 76235) and acetic acid (Fisher Scientific, A385) diluted in 5% volume to volume in water — using a stimulus controller (Ockenfels Syntech ...
-
bioRxiv - Synthetic Biology 2020Quote: 0.63 mmole (1 equivalent) of the nucleoside-5’-monophosphate free acid (Santa Cruz Biotechnology or ACROS Organics) and 5 equivalents of 2-aminoimidazole hydrochloride (Combi-Blocks ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% sodium dodecyl sulfate and 5 mM ethylenediaminetetraacetic acid with protease and phosphatase inhibitors (Thermo Fisher Scientific). Cell lysates were centrifuged at 500 g for 30 minutes at 4°C to remove cellular debris ...
-
bioRxiv - Biophysics 2024Quote: ... cells were harvested using premixed Earle’s balanced salt solution with 5 mM ethylenediaminetetraacetic acid (EDTA) (Life Technologies) and centrifuged at 3000 rpm for 10 min at 21 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The digestion was quenched with 5% formic acid and desalted either using C18 tips (Thermo Fisher 87782) or equal mix of Sera-Mag Carboxylate SpeedBeads (Cytiva 65152105050250 & 45152105050250)100 ...
-
bioRxiv - Bioengineering 2022Quote: ... all syntheses were cleaved from resin with 5 mL of 92.5:2.5:2.5:2.5 trifluoroacetic acid (>95%, Fisher Scientific):DI water:triisopropylsilane (98% ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 μM diethyldithiocarboxamic acid ammonium salt (all reagents from either Thermo Fisher Scientific or Sigma Aldrich). CMH aliquots were stored at -20°C until use ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were extracted by incubating with 100% ACN followed by 50% ACN/5% formic acid (Thermo Fisher) for 15 mins each at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested using 0.05% trypsin/5 mM ethylenediaminetetraacetic acid (EDTA; Thermo Fisher Scientific, Landsmeer, The Netherlands) and counted using trypan blue (Sigma–Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... TMCSH was dissolved overnight under stirring at room temperature (RT) in 5 mM hydrochloric acid (Fisher Scientific). Then ...
-
bioRxiv - Cancer Biology 2020Quote: ... and ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/ml sodium selenite, Invitrogen). SK-N-BE (2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 incubator with 5 μM MitoSox Red (Thermo Fisher) in MAS (70mM sucrose ...
-
bioRxiv - Genetics 2020Quote: ... each well contained: 5 μL 5× Phusion HF buffer (ThermoFisher), 17.25 μL dH2O ...
-
bioRxiv - Microbiology 2021Quote: ... 5% A+ human serum and 5% AlbuMAX II (Life Technologies). Gametocyte media was changed daily without the addition of fresh erythrocytes for 14 days following induction ...
-
bioRxiv - Microbiology 2023Quote: ... and m7 G(5′)ppp(5′)G Cap Analog (Ambion). BHK-21 cells in 6-well plates were transfected with the capped-SINV-AaBec243-260-mCh-Flag or capped-SINV-mCh-Flag mRNA using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... 5% Pen-Strep and 5% glutamine (Thermo Fisher Scientific #25030081) 1-2 hours before transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 0.2 mM 5-ethynyl uridine (5-EU) (Thermo Fisher) in media for 30 minutes according to kit instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... 5 × 106 cells were cultured in 3 ml Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... and then 3 hours at 37°C with 5 μg/mL mouse laminin (Thermo Fisher). Neurons are cultured in BrainPhys neuronal medium (Stemcell Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... Cells were disrupted by passing them 3-5 times through a French press (Thermo Fisher) and centrifuged for 50,000g for one hour at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 μL of a heavy-weight dextran (Invitrogen, Cat#D1818, 70,000 MW, lysine fixable) was injected into each juvenile octopus and allowed to circulate throughout the body for 5 minutes ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... and the cells resuspended in 3-5 mL of pancreatosphere medium (DMEM/F12 (Gibco, #11320033), 1% P/S ...
-
bioRxiv - Genetics 2024Quote: Cell pellets (1 x 10^5 – 3 x 10^6) were washed with PBS (Gibco), resuspended in RLB (10 mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: Mice were injected with 100 μg of 5-ethynyl-2’deoxyuridine (EdU, Invitrogen) 2 hours prior to splenocyte harvest ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 50-100 nl of 1 mM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) at stage 41 ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were counterstained with 2 μM CellTracker Green (5-chloromethylfluorescein diacetate dye) (ThermoFisher) followed by NucBlue (ThermoFisher ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM tris(2-carboxyethyl)phosphine (TCEP, Bond-Breaker, neutral pH, Thermo Scientific) was added and samples were incubated at room temperature for 20 min ...