Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... isolated cerebral microvessels (5 animals per group) or hippocampus (3-5 animals per group) using Trizol (ThermoFisher, MA) and the Qiagen RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... 150 mM KCl, 1 mM EDTA ethylenediaminetetraacetic acid [EDTA], 2 mM MgCl2, 0.5 mM ATP, 0.02% Brij-35 [ThermoFisher Scientific], 5 mM 2-ME, pH 8.0) supplemented with 50 U ml-1 Benzonase (Merck-Millipore) ...
-
bioRxiv - Genetics 2020Quote: ... and 400 µl of 5% aqueous formic acid (Optima grade, Fisher Scientific), vortexed for 30 seconds and centrifuged at 8000 x g for 2 min at 10° C ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 ml MEM Nonessential Amino Acids (Thermo Fisher Scientific, cat. no 11140035), 1 ml 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... + 5% FBS + non-essential amino acids (Gibco, Gaithersburg, MD-Stock# 11140-050), penicillin-streptomycin (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and were resuspended in 5% acetonitrile with 0.1% formic acid (Thermo Scientific). The resulting peptides were quantified by fluorometric peptide assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in 1 ml of 5% trichloroacetic acid (SA433, Thermo Fisher Scientific) and incubated at 4°C for a minimum of 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml of MEM non-essential amino acids solution (Thermo Fisher Scientific), 3.5 ml of 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were treated with 5% periodic acid (Thermo Fisher Scientific, MA, USA) for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies, 11140050). At 4 days after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with 0.5 µM Lipi-Deep Red neutral lipid stain (Dojindo #LD04-10) for 2 hr and 5 µg/mL Hoeschst 33342 nucleic acid stain (Invitrogen #H3570) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 20% volume of 1M 2-morpholin-4-ylethanesulfonic acid (MES) pH 5 and Immobilized Protein G resin (Thermo Scientific Prod#20397) were added to supernatant and sample was incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were trapped at 20 μL/min in a loading solvent (2% ACN, 0.05% trifluoroacetic acid) on a 5 mm × 300 μm C18 PepMap cartridge pre-column (Thermo Fisher Scientific) for 5 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequently a copy of chromosome XV was removed by counter-selection against the URA3 gene by replica-plating on SD medium containing 1 mg/mL 5-fluoroorotic acid (5-FOA, ThermoFisher Scientific) from a 100 mg/mL stock in DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... Columbia colistin and nalidixic acid (CNA) agar with 5% sheep blood (5%SB-CNA) and chocolate agar medium agar plates were purchased from Fisher Scientific.
-
bioRxiv - Molecular Biology 2024Quote: ... High titer wild-type or mutant Churi was mixed with the culture at MOI of 5 and incubated at 30°C for 20 minutes before adding 5 µM SYTOX Green Nucleic Acid Stain (Thermo Fisher). Next ...
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Biophysics 2021Quote: ... Then 2 equivalents of fluorescein-5-maleimide (Invitrogen, #F150) was added and the mixture was incubated at room temperature for 20 min ...
-
bioRxiv - Neuroscience 2022Quote: ... EdU (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific, cat# A10044) staining was performed by Click-it Alexa Fluor 647 imaging kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 ng/ml IL-2 (Thermo Fisher Scientific), and then resuspended with 1 ml of virus per 6 x 106 cells ...
-
bioRxiv - Cell Biology 2021Quote: 0.1mg of 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen, A10044) dissolved in PBS (50ul ...
-
bioRxiv - Developmental Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen A10044, Carlsbad, CA) dissolved in PBS was administered to mice at indicated postnatal days ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μM 5-ethynyl-2’-dexoyuridine (EdU, ThermoFisher Scientific) was added to the culture media for 2 hours ...
-
bioRxiv - Developmental Biology 2021Quote: 5-ethynyl-2′-deoxyuridine (EdU) was purchased from ThermoFisher and stock solutions were created by dissolving the powder in dimethyl sulfoxide as instructed by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: 5-ethynyl-2’-deoxyuridine (EdU, Molecular Probes, Life Technologies) was dissolved in DMSO to make a 10mM stock solution ...
-
bioRxiv - Cancer Biology 2021Quote: 5-ethynyl-2’-deoxyuridine (EdU, Molecular Probes, Life Technologies) was dissolved in DMSO to make a 10mM stock solution ...
-
bioRxiv - Genomics 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) (Thermo Fisher Scientific, A10044) was added to culture media at 10 µM final concentration for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg plasmid and 5 μl Lipofectamine 2000 (Invitrogen) were diluted into 200 μl Opti-MEM (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of 5 × Maxima RTA buffer (Thermo Scientific), which were mixed with Ultrapure water (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FCS and 2% B-27 (Gibco) and maintained at 5% CO2 and 37°C in humidified incubators ...
-
bioRxiv - Neuroscience 2024Quote: EdU (5-ethynyl-2’-deoxyuridine; #A10044, Thermo Fisher Scientific) was diluted at 10mg/ml in 0.9% NaCl (#114-055-101 ...
-
bioRxiv - Neuroscience 2024Quote: EdU (5-ethynyl-2’-deoxyuridine; #A10044, Thermo Fisher Scientific) was diluted at 10mg/ml in 0.9% NaCl (#114-055-101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridne) (Thermo Fisher Scientific, #A10044) for 4 hours after incubating cells with serum-deprived media (RPMI +10% FBS ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or SM/5 plates (2 g glucose (Fisher Scientific), 2 g BactoPeptone (Oxoid) ...