Labshake search
Citations for Thermo Fisher :
3701 - 3750 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Genetics 2021Quote: Human neural stem cells derived from H9 (WA09) human embryonic stem cells were purchased from Thermo Fisher. The cells were cultured in complete StemPro NSC SFM (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: NSChIPS (Human Neural Stem Cells derived from the human induced pluripotent stem (iPS) cell line) (ThermoFisher, #A3890101)
-
bioRxiv - Genomics 2019Quote: ... a mixture of 23 normal human tissues (including brain) and First Choice Human Brain reference RNA (Ambion), a pool of normal human brain tissues (labeled B) ...
-
bioRxiv - Immunology 2022Quote: ... The human codon-optimized Bcl6-P2A-human codon-optimized Bcl-xL insert was synthesized using GeneArt (ThermoFisher) and cloned into pLZRS-IRES-GFP ...
-
bioRxiv - Immunology 2020Quote: ... Fresh primary human T cells were isolated and cultured with anti-human CD3/CD28 beads (Dynabeads, ThermoFisher), 500U/mL IL-2 (Proleukin ...
-
bioRxiv - Molecular Biology 2021Quote: Human adipose-derived stem cells (ASCs) and human microvascular endothelial cells (HMVEC) were purchased from Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Primary human epidermal melanocytes (MC) and primary human epidermal keratinocytes (KC) were obtained from Invitrogen (NY, USA). MC was cultured in Medium
-
bioRxiv - Molecular Biology 2022Quote: ... Human TNF-α Ultrasensitive ELISA Kit (Invitrogen,KHC3014 [96 tests] and Human IFNα ELISA Kit [Invitrogen,BMS216TEN]) were used for cytokine quantification.
-
bioRxiv - Biochemistry 2023Quote: ... 1.0 mg/mL recombinant human insulin, 0.55 mg/mL human transferrin, 0.67 μg/mL sodium selenite, Gibco), and 0.04 μg/mL dexamethasone (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human and non-human primate OBs were sectioned following embedding in optimal cutting temperature (O.C.T.) compound (ThermoFisher). One human non-synucleinopathy case was obtained from banner health embedded in paraffin wax (Specimen details see Table 1 and SI Appendix Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... T cells were isolated from human PBMCs with an Untouched Human T-cell Isolation Kit (Invitrogen, USA) and activated with Dynabeads Human T Activator CD3/CD28 (Gibco ...
-
bioRxiv - Immunology 2023Quote: Primary human T cells were pre-activated with DynabeadsTM human T-Activator CD3/CD28 beads (Gibco, #11131D) at a 1:1 ratio of cells:beads with 100 IU/ml IL-2 (Chiron #53905-991-01 ...
-
bioRxiv - Physiology 2024Quote: Human: Total RNA was extracted from human RV tissue using TRIzol (Ambion by Life Technologies, Ref#15596018). cDNA was prepared using qScript Flex cDNA Synthesis Kit from (Quanta Bio ...
-
bioRxiv - Physiology 2024Quote: Human: Total RNA was extracted from human RV tissue using TRIzol (Ambion by Life Technologies, Ref#15596018). cDNA was prepared using qScript Flex cDNA Synthesis Kit from (Quanta Bio ...
-
bioRxiv - Neuroscience 2024Quote: ELISAs for human Aβ40 and human Aβ42 were carried out using commercial kits (Aβ40: Invitrogen KHB3481; Aβ42: Invitrogen KHB3441) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Biochemistry 2019Quote: ... 50 × 3 mm (Thermo Scientific). The mobile phase consisted of 100 mM ammonium carbonate (A ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 mM glutamine (Life Technologies), 10% dialyzed fetal bovine serum (dFBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... and toto-3 (Life Technologies) were used after primary antibody incubation.
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...
-
bioRxiv - Bioengineering 2020Quote: ... SP-DiOC18(3) (ThermoFisher Scientific) for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: sucrose (Fisher Scientific #S5-3), cellobiose [D-(+)-cellobiose ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM NaOH (Fisher Scientific) in neurobasal medium] and centrifugation at 800 × g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuantStudio 3 system (Thermofisher) was used for reactions under the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... and 3 μl RNAiMAX (Invitrogen). For every gene ...
-
bioRxiv - Microbiology 2020Quote: ... using a QuantStudio 3 (ThermoFisher). KiCqStart SYBR green primers for qRT-PCR (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 3) Accutase (Thermo Fisher Scientific) treatment for 15 min (Figure 4E) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-galectin 3 (ThermoFisher). Membranes were imaged using LI-COR Odyssey IR imager ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3% sodium bicarbonate (Gibco). A549 (ATCC CCL-185 ...
-
bioRxiv - Cancer Biology 2021Quote: ... YOYO-3 (Thermo Fisher Scientific) was supplemented to the culture to detect cellular death ...
-
bioRxiv - Cell Biology 2022Quote: ... Following 3 PBS (ThermoFisher Scientific) washes ...
-
bioRxiv - Microbiology 2022Quote: ... Quantstudio 3 software (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... IL-18 (Invitrogen, BMS618-3) and TNF-α (BioLegend ...
-
bioRxiv - Developmental Biology 2022Quote: ... or TO-PRO-3 (Invitrogen) for 10 min at RT or O/N at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 3 mL (Thermo Fisher Scientific) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (Molecular Probes) or 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Cell Biology 2020Quote: ... A QuantStudio 3 (Applied Biosystems) real-time thermocycler was used with the cycling conditions of 50 °C for 2 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 micron (Thermofisher Scientific, USA). The mobile phase contained water/methanol (40:60 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cy-3 (A1051, Molecular probes), Alexa Fluor 647 (A21235 ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µg/ml Puromycin (Gibco) was added 48 hours after transduction before KD analysed via qPCR and western blot if appropriate.
-
bioRxiv - Bioengineering 2020Quote: 3-nitrophenylhydrazine (N02325G, Fisher Scientific), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide HCl (50-848-678 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 mM Magnesium Chloride (Ambion) and 6 U/ml Thermolabile proteinase K (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... or phase 3 (Affymetrix Axiom) reference panels (Supplemental Tab ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 µL TCEP (Invitrogen) was added and the sample heated to 95 °C for 10 min ...