Labshake search
Citations for Thermo Fisher :
3451 - 3500 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Individual plasmids or combinations of (sub)species-specific gH and gL expression plasmids were transfected into FreeStyle 293-F cells (Thermo Fisher Scientific) using polyethylenimine (PolySciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1-LZTR1-Myc-6xHis plasmid was a gift from Jens Kroll (Heidelberg University and German Cancer Research Center (DKFZ-ZMBH Alliance)).56 The LZTR1L580Pvariant was introduced into the plasmid by site-directed mutagenesis as previously described.11 Cells were transfected using ExpiFectamine 293 Reagent (Thermo Fisher Scientific) and cultured at a density of 3-5×106 cells/ml in a 37°C incubator with ≥80% relative humidity and 8% CO2 on an orbital shaker at 125×g for 3-4 days ...
-
bioRxiv - Immunology 2023Quote: ... comprising the variable heavy chain and light chains joined with the 15-residue linker was transiently expressed in a secreted form using FreeStyle™ 293-F cells (Thermo Fisher) in FreeStyle™ F17 Expression Medium supplemented with L-glutamine and 1x MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Biochemistry 2023Quote: ... Expi293F cells were grown at 37℃ with 8% CO2 and DNA transfections were conducted with the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell culture supernatants were harvested three days post transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK-293 cells with 80% of confluency were transfected using 250ng/ml of pCMVHA hEZH2 and Lipofectamine 2000 (#11668030, Invitrogen, Thermo Fisher Scientific) for 4 hrs ...
-
bioRxiv - Neuroscience 2023Quote: ... was expressed in Expi293 cell line (3X106 cells/ml, 200 ml in 1 L flask) using ExpiFectamine™ 293 Transfection Kit (Gibco, A14524). After 48 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified pOG44 and pcDNA5/FRT-SUGCT plasmids were co-transfected into Flp-In 293 cells at a 9:1 ratio by using Lipofectamine 2000 reagent (Invitrogen, Thermo Fisher Scientific). Flp-In 293 cells were cultured in DMEM supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... The ectodomain of ancestral SARS-CoV-2 spike (GenBank: MN908947.3) was expressed as previously described.10 The protein was purified from FreeStyle 293-F cells (Thermo Fisher Scientific, USA) using affinity chromatography followed by size exclusion chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... 1 L of Expi293 cells were grown at 37 °C under a 5% CO2 atmosphere in Gibco® FreeStyleTM 293 Expression Medium (ThermoFisher Scientific) to reach the density of 2 × 106 mL-1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Expi293F cells were grown at 37℃ with 8% CO2 and DNA transfections were conducted with the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell culture supernatants were harvested four days post-transfection and proteins were purified using HisTrap™ High Performance column (Cytiva) ...
-
bioRxiv - Cell Biology 2023Quote: ... SJ293TS cells were transfected with the transfer vector and the helper plasmids pCAG-kGP1-1R, pCAG-VSVG and pCAG4-RTR2 using PEIpro (Polyplus Transfection, Strasbourg, France) and grown in Freestyle 293 Expression media (Thermo Fisher Scientific) at 37°C with 8% CO2 and shaking at 125 RPM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... proteins were transiently expressed in FreeStyle 293-F cells using pSecTag2A plasmids and 293Fectin transfection reagent according to the suppliers’s protocol (Thermo Fisher Scientific; 12347019). 4-6 days after transfection ...
-
bioRxiv - Immunology 2023Quote: ... The HA–6XHIS and HA–AviTag constructs for each HA were co–transfected using 293Fectin Transfection Reagent into FreeStyle™ 293–F Cells (ThermoFisher Scientific) at a 2:1 ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... Expi293F cells were grown at 37℃ with 8% CO2 and DNA transfections were conducted with the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell culture supernatants were harvested four days post-transfection and proteins were purified using HisTrap™ High Performance column (Cytiva) ...
-
bioRxiv - Biophysics 2023Quote: S1PR1-Flag and CD69-StrepII were separately expressed using baculovirus-mediated transduction of mammalian HEK293S GnTI− cells (ATCC CRL-3022) in a medium containing FreeStyle 293 (Gibco Cat# 12338018) supplemented with 2% charcoal-dextran stripped fetal bovine serum (Gibco Cat# 12676029) ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were produced by transient co-transfection of Expi293F cells (maintained in serum-free Expi293 Expression Medium) with heavy- and light-chain constructs using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific), and subsequently purified using Protein G Sepharose 4 Fast Flow (GE Healthcare) ...
-
bioRxiv - Biophysics 2023Quote: ... After verification by sequencing the constructs were subsequently introduced into Flp-In™ T-REx™ 293 cells (Life Technologies, Carlsbad, CA) as described by Liu et al 52,53.
-
bioRxiv - Immunology 2024Quote: ... these plasmids were co-transfected into Expi293F suspension cells using lipid based ExpiFectamine 293 transfection kit (catalog no. A14525, Thermo Fisher Scientific). All procedures followed the guidelines outlined in the Life Technologies ExpiFectamine 293 transfection kit ...
-
bioRxiv - Molecular Biology 2024Quote: Clu constructs were expressed and secreted by the respective HEK293E stable cell lines cultured in FreeStyle 293 Expression Medium (Thermo Fisher Scientific) for 4 days ...
-
bioRxiv - Biochemistry 2024Quote: Inducible cell lines for the expression of POLγA variants were established using the Flp-In™ T-REx™ 293 host cell-line (ThermoFisher Scientific) as described previously (6) ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-REx 293 stable cell lines containing a doxycycline-inducible construct were generated using the Flp-In system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using Taqman probes (human RBM10: Assay ID, Hs00275935_m1, human Bcl-xL: Assay ID, Hs00236329_m1, Applied Biosystems, human Bcl-xS ...
-
bioRxiv - Biochemistry 2022Quote: ... Human serum (catalog # 4522 from human male AB plasma) and fetal bovine serum were from Gibco, Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and plasma human glucagon was measured by the human glucagon ELISA kit (Thermo Scientific, Frederick, MD). Exendin-4 plasma levels were measured using the exendin-4 EIA kit (Phoenix pharmaceuticals ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 50 μL fresh FACS buffer and 10 μL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Cell Biology 2023Quote: ... Fragments of human CCDC22 and CCDC93 and full-length human DENND10 were ordered as GeneStrings (ThermoFisher) with the gene codon optimized for E ...
-
bioRxiv - Neuroscience 2023Quote: ... Secreted Aβ42 peptides were quantified using the Human Amyloid β1-42 human ELISA kit (Thermo Fisher) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Fresh human BAL cells and frozen human PBMCs were stained with Aqua live/dead dye (Invitrogen) for 20min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Jurkat T cells and human THP-1 monocytes were cultured in RPMI 1640 medium (ThermoFisher), supplemented with 10% FBS ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 50 µL fresh FACS buffer and 10 µL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 50 µL fresh FACS buffer and 10 µL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Immunology 2022Quote: ... Total IgG in human sera was measured using a commercial human IgG ELISA kit (Fisher Scientific) according to manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... All human CD8+ T cells were activated with anti-human CD3/CD28 dynabeads (11131D, Thermo Scientific) at a 1:1 cell-to-bead ratio and cultured in complete RPMI supplemented with 10% FBS ...
-
bioRxiv - Immunology 2022Quote: ... 100 ng/mL Human Recombinant IL-4 and 250 ng/mL Human Recombinant GM-CSF (ThermoFisher) for six days at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified human neutrophils and T cells were cultured in Human Plasma-Like Medium (HPLM; ThermoFisher Scientific) with 5% heat inactivated FBS supplemented ...
-
bioRxiv - Immunology 2023Quote: ... Primary human T cells were thawed and activated with Human T-Expander CD3/CD28 Dynabeads (Gibco) at a 3:1 bead:cell ratio in complete medium (RPMI 1640 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Cancer Biology 2021Quote: ... human melanocyte growth supplement (HMGS, Gibco), gentamicin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pool A (human) (Thermo Fisher Scientific) using the TaqMan® microRNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... human skeletal myoblasts (Thermo Fisher Scientific), and mouse C3H muscle myoblasts (C2C12 cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... with human melanocyte growth supplements (Gibco). Cell lines were incubated at 37 °C in 5% CO2.
-
bioRxiv - Cancer Biology 2021Quote: Human melanocytes were trypsinized (Gibco, 25300062), quenched ...
-
bioRxiv - Systems Biology 2021Quote: ... The human 62-plex (eBiosciences/Affymetrix) was utilized with the modifications described below ...