Labshake search
Citations for Thermo Fisher :
3401 - 3450 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Expi293F cells were grown at 37℃ with 8% CO2 and DNA transfections were conducted with the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell culture supernatants were harvested four days post-transfection and proteins were purified using HisTrap™ High Performance column (Cytiva) ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using Taqman probes (human RBM10: Assay ID, Hs00275935_m1, human Bcl-xL: Assay ID, Hs00236329_m1, Applied Biosystems, human Bcl-xS ...
-
bioRxiv - Biochemistry 2022Quote: ... Human serum (catalog # 4522 from human male AB plasma) and fetal bovine serum were from Gibco, Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and plasma human glucagon was measured by the human glucagon ELISA kit (Thermo Scientific, Frederick, MD). Exendin-4 plasma levels were measured using the exendin-4 EIA kit (Phoenix pharmaceuticals ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 50 μL fresh FACS buffer and 10 μL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Immunology 2022Quote: ... Total IgG in human sera was measured using a commercial human IgG ELISA kit (Fisher Scientific) according to manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... All human CD8+ T cells were activated with anti-human CD3/CD28 dynabeads (11131D, Thermo Scientific) at a 1:1 cell-to-bead ratio and cultured in complete RPMI supplemented with 10% FBS ...
-
bioRxiv - Immunology 2022Quote: ... 100 ng/mL Human Recombinant IL-4 and 250 ng/mL Human Recombinant GM-CSF (ThermoFisher) for six days at 37°C and 5% CO2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 50 µL fresh FACS buffer and 10 µL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 50 µL fresh FACS buffer and 10 µL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Neuroscience 2023Quote: ... Secreted Aβ42 peptides were quantified using the Human Amyloid β1-42 human ELISA kit (Thermo Fisher) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Fresh human BAL cells and frozen human PBMCs were stained with Aqua live/dead dye (Invitrogen) for 20min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Fragments of human CCDC22 and CCDC93 and full-length human DENND10 were ordered as GeneStrings (ThermoFisher) with the gene codon optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified human neutrophils and T cells were cultured in Human Plasma-Like Medium (HPLM; ThermoFisher Scientific) with 5% heat inactivated FBS supplemented ...
-
bioRxiv - Immunology 2023Quote: ... Primary human T cells were thawed and activated with Human T-Expander CD3/CD28 Dynabeads (Gibco) at a 3:1 bead:cell ratio in complete medium (RPMI 1640 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Jurkat T cells and human THP-1 monocytes were cultured in RPMI 1640 medium (ThermoFisher), supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cancer Biology 2021Quote: ... human melanocyte growth supplement (HMGS, Gibco), gentamicin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pool A (human) (Thermo Fisher Scientific) using the TaqMan® microRNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... human skeletal myoblasts (Thermo Fisher Scientific), and mouse C3H muscle myoblasts (C2C12 cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... human keratinocyte growth supplement (ThermoFisher Scientific), and penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2019Quote: Episomal human iPSCs30,31 (Thermo Fisher Scientific) were maintained as a monolayer on Matrigel (Corning Life Sciences ...
-
bioRxiv - Cancer Biology 2020Quote: ... with human melanocyte growth supplements (Gibco). Cell lines were incubated at 37 °C in 5% CO2.
-
bioRxiv - Molecular Biology 2019Quote: ... Human colon total RNA (Thermofisher Scientific) was aliquoted at 13 µg/mL and stored at −20°C
-
bioRxiv - Cancer Biology 2021Quote: Human melanocytes were trypsinized (Gibco, 25300062), quenched ...
-
bioRxiv - Systems Biology 2021Quote: ... The human 62-plex (eBiosciences/Affymetrix) was utilized with the modifications described below ...
-
bioRxiv - Bioengineering 2020Quote: ... PE-conjugated anti-human CXCR4 (Invitrogen), FITC-conjugated anti-human ACE2 (R&D Systems) ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant human TGF-β1 (Life Technologies) was prepared in sterile water with 0.1% BSA following the manufacturer’s instructions and diluted in 50:50 media.
-
bioRxiv - Genomics 2021Quote: ... Human neural stem cells (NSCs) (Gibco, a kind gift from Raymond Poot ...
-
bioRxiv - Cell Biology 2021Quote: ... and human ATF4 (Ambion, USA, 16708), and Scrambled (Negative control ...
-
bioRxiv - Microbiology 2020Quote: Normal Human Dermal Fibroblasts (NHDF; Gibco) and IRF3 -/- cells were maintained in Dulbecco’s modified high glucose media (DMEM ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-human (ThermoFisher, 1:1000). Hoechst staining (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: Normal human dermal fibroblast (NHDF, Gibco) cells were maintained in Dulbecco’s modified high glucose medium (DMEM ...
-
bioRxiv - Immunology 2020Quote: ... goat anti-human IgM (Invitrogen #A18835), or goat anti-human IgA (Jackson #109-036-011 ...
-
bioRxiv - Biochemistry 2020Quote: ... CD45 (Human CD45 FITC Conjugate, Invitrogen), CD90 (PE Mouse Anti-Human CD90 BD Pharmingen ...