Labshake search
Citations for Thermo Fisher :
301 - 350 of 711 citations for Diphtheria Toxin CRM197 Mutant since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... WT and homozygous PINK1Q456X mutant fibroblasts were seeded in 96-well imaging plates (Fisher Scientific, 08772225) and allowed to attach overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... Database search and mutant/WT ratio calculation were performed using Proteome Discovery 2.4 (Thermo Fisher Scientific) against Sprot Mouse database ...
-
bioRxiv - Biophysics 2024Quote: ... The constructs (tβ1AR and L72A mutant isoform) were over expressed in insect cells (sf9, Invitrogen, 11496015) using the Bac-to-Bac baculovirus expression system (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2024Quote: ... The triple 3A mutant fragment was cloned into pENTR-D-TOPO (Thermo Fisher Scientific, MA, USA). The 3A mutant was used as a template to generate the 5A mutant ...
-
bioRxiv - Plant Biology 2023Quote: ... the MADA motif mutant of SlNRC0 was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher) with forward mutation primer (AATGGTCTCTAATGGCTGATGCTGTTGTCGAATTTGAATTGTTAAATGAGAAAC AACTAGAACTTTATCATGTGGATTTG ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant GCase N370S mutant was produced by using 293T Freestyle cells (Thermo Fisher Cat. No. R79007) grown in suspension in 293 Freestyle medium (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the CeA of the rats were injected with 200 nl of retrograde tracer cholera toxin B Alexa Fluor 488 conjugate (CTB, Life Technologies, C34775). All surgical instruments were sterilized before surgery ...
-
bioRxiv - Neuroscience 2022Quote: ... of 0.2% cholera toxin subunit B – Alexa Fluor 555 (CTB555) or 488 (CTB488) conjugate (C22843 or C-22841, Thermo fisher Scientific, Inc.) in 0.1 M phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2020Quote: ... and a Nanoinject III was used to deliver 500 nL of the fluorescently conjugated retrograde tracer cholera toxin subunit B-Alexa Fluor 647 (CTB, Thermofisher C34778, C22843) at a rate of 5 nL/s ...
-
bioRxiv - Neuroscience 2021Quote: Rats (N = 4) were infused unilaterally with AlexaFluor-594 conjugated cholera toxin B (CTb; 5 μg/μL; Life Technologies, San Diego, CA) into the mOFC (AP +4.1 ...
-
bioRxiv - Neuroscience 2021Quote: ... 90 nl of Cre-expressing lentivirus (LVretro-Cre) (Knowland et al., 2017) was mixed with cholera-toxin B subunit (CTb) conjugated to Alexa 488 (Thermo Fisher Scientific) at 1:1 ratio and was injected into the GPe (in mm ...
-
bioRxiv - Neuroscience 2023Quote: A glass micropipette filled with a solution containing AAV or cholera toxin b-subunit (CTb) conjugated with Alexa Fluor 488 (Alexa488) or Alexa594 (1 mg/ml; C22841 and C22842, Thermo Fisher Scientific) was perpendicularly inserted into the LPB ...
-
bioRxiv - Microbiology 2021Quote: ... perRB (M1474) and double perRAperRB mutant strains were harvested and resuspended in 1 ml TRIzol (ThermoFisher Scientific) and stored at -80°C ...
-
bioRxiv - Genetics 2020Quote: ... total RNA was isolated from 10 Bmfru mutant and WT antennas using TRIzol (Invitrogen, Carlsbad, CA, USA), and the residual DNA was removed with RNase-free DNase I (New England BioLabs ...
-
bioRxiv - Synthetic Biology 2019Quote: CggR wildtype and the generated mutants were cloned in pET100/D-TOPO (Thermo Fisher Scientific; Waltham, MA), with an N-terminal His6-tag and expressed in E ...
-
bioRxiv - Molecular Biology 2020Quote: ... and transfected into wild type or mutant HCT116 cell lines following standard Lipofectamine 3000 protocols (Invitrogen L3000). Stable cell lines were generated using puromycin selection (1 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... Wild type (WT) HCT116 cells and those expressing Sec61 mutants were maintained in McCoyS 5A Medium (Gibco) and 10% FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Where indicated plasmid expressing wild type DHX9 or S990A mutant was transfected using lipofectamine 2000 reagent (Invitrogen) for 48 hours ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellets expressing the GOT1-GFP and its mutants were lysed with Cell Extraction Buffer (Invitrogen) mixed with a protease inhibitor cocktail (cOmplete Mini ...
-
bioRxiv - Cell Biology 2021Quote: ... Myo21 heterozygous mutants were maintained in the same medium with 10 μg ml−1 hygromycin B (Invitrogen). Episomally complemented heterozygous Myo21 mutants were maintained in the same medium with 10 μg ml−1 of hygromycin B and 10 μg ml−1 of G418 Sulfate (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: MtROS have been detected in live wt and ahr-1 mutants worms using MitoSOX Red (ThermoFisher Scientific). Nematodes have been synchronized by egg-laying onto IPTG plates using HT115(L4440 ...
-
bioRxiv - Immunology 2022Quote: ... A31 cells were transfected with equal amounts of WT or mutant viral DNA using Lipofectamine 3000 (ThermoFisher). At 24 hours the media was removed ...
-
bioRxiv - Plant Biology 2021Quote: ... Confirmation of the aha5-2 mutant line was performed using TaqMan Gene expression Assay kits (Applied Biosystems) for HA5 (Assay ID At02274124_g1 ...
-
bioRxiv - Microbiology 2022Quote: Various Ord95 mutants were constructed by Phusion™ Site-Directed Mutagenesis Kit (Thermo Fisher Scientific, United States). The procedures for the expression and purification of these variants were similar to that of wild type Ord95.
-
bioRxiv - Plant Biology 2021Quote: ... WT RBA1 (residues 1-363) and RBA1 mutant proteins were cloned into the pFastBac 1 vector (Invitrogen) with an N-terminal SUMO-6×His tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected with pCMV6 vectors bearing WT or mutant receptors using Lipofectamine 3000 transfection reagent (Invitrogen). Following 24 h culturing ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions for colony screening and verification of mutants were done using Taq DNA polymerase (Thermo Scientific). For expression of proteins in E ...
-
bioRxiv - Neuroscience 2023Quote: RNAs from brain were extracted from Cib2;Cib3 mutant and control mice using the Ribopure kit (Ambion). SMARTScribe Reverse Transcriptase kit (Clontech ...
-
bioRxiv - Bioengineering 2023Quote: ... we cloned the PCR products of putative mutant individuals using TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA) before sequencing following the instructions with some modifications ...
-
bioRxiv - Biophysics 2023Quote: ... Cumulative pore mutants were generated by Gibson assembly (GeneArt Gibson Assembly kit, Thermo Fisher Scientific, Waltham MA) following manufacturer’s instructions and using a gBlock (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lentiviral vector for tetracycline-inducible expression of the Gαi2R179C and GαoAR243H mutants was constructed by first cloning Gαi2R179C and GαoAR243H from pcDNA3.1 to pENTR vector (Thermofisher Scientific) and then into the destination vector pLIX_402 (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: His-mATGL and its point mutants were recombinantly expressed in Expi293FTM cells (Thermo Fisher Scientific, Waltham, USA). The cells were cultivated in Expi Expression Medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... The mutants of Vpr were produced by site-directed mutagenesis according to Phusion polymerase manufacture guide (Thermofisher) or CloneAmp HiFi polymerase manufacture guide (Takkara ...
-
bioRxiv - Genomics 2023Quote: ... The 5′ UTR mutants were generated using the NEB Q5 Site-Directed Mutagenesis Kit (Fisher Scientific, E0554S) according to manufacturer recommendations but extending the KLD reaction to 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... whereas MICU3 and EFHD1 EF-hand mutants were synthesized in the pUC57 vector (Thermo Fisher Scientific, SD0171) and cloned into a pDONR221 vector with the following primers ...
-
bioRxiv - Developmental Biology 2024Quote: Capped mRNA for mutant rescue was generated using the mMESSAGE mMACHINE™ SP6 Transcription Kit (AM1340, Ambion) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... pairwise injections of 80 nL of 0.5% (wt/vol) fluorescently labeled cholera toxin B subunit (CTB-488, ThermoFisher C22841, CTB-647, ThermoFisher C34788). In C57BL6/J mice ...
-
bioRxiv - Neuroscience 2020Quote: Mice used for retrograde tracing experiments received cholera toxin b subunit (CTB) conjugated with Alexa Fluor 488 and/or Alexa Fluor 647 (CTB-488 and CTB-647; ThermoFisher, C34775 and C34778).
-
bioRxiv - Microbiology 2021Quote: ... 50 μl PCR reactions were carried out using 10 ng of sample DNA template and toxin-specific gene primers (Table 3) along with Platinum™ Taq Polymerase (Invitrogen/ThermoFisher, Carlsbad, CA) in accordance with the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... the left hemisphere VMH was pressure injected with 180 nl of a bi-directional neural tracer cocktail consisting of 5 μg/μl retrograde Cholera toxin subunit B conjugated with Alexa Fluor 488 (Life Technologies, cat# C22841) and 50 μg/μl anterograde dextran amine 10,000 MW conjugated with Alexa Fluor 488 (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... The injections were either a fluorescent dextran amine or a recombinant cholera toxin subunit B tracer: (Dextran-405; CTB-488, CTB-594, CTB-647, Invitrogen #C22841, #C34777, #C34778). We chose our injection volume based on the size ...
-
bioRxiv - Neuroscience 2023Quote: Animals that underwent optic nerve crush surgeries were intravitreally injected on the surgical eye with 2 µl of Alexa 594-conjugated-cholera toxin β (Life technologies #C22842) at day 14 ...
-
bioRxiv - Neuroscience 2023Quote: ... A small hole was made in the eye using a sterile 34-gauge needle and ∼0.5 μl of cholera toxin subunit B conjugated with Alexa Fluor 488 (CTB-488, ThermoFisher Scientific, Catalogue Number: C34775) diluted in 0.9% sterile saline was intravitreally pressure-injected into the right eye using a pulled-glass micropipette coupled to a Picospritzer (Parker Hannifin).
-
bioRxiv - Immunology 2024Quote: ... Quantification of the Alexa Fluor® 647 ratio per tetanus toxin was obtained by scanning measurements using the NanoDrop One c device (Thermo Fisher Scientific) with 280 and 650 nm readings ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected for 48 hours with wild-type or mutant versions of SAF-A-GFP using 2.5 μg plasmid DNA and 2.0 μL Lipofectamine 3000 (Invitrogen). Three independent transfections were analyzed to assess the frequency of the phenotypes reported in Figures 4 and 5.
-
bioRxiv - Molecular Biology 2019Quote: Wild-type and indicated mutants of MmEsco1 were cloned into pEF6/Myc-His B vector (Thermo Fisher Scientific) containing C-terminal myc and His tags ...
-
bioRxiv - Biophysics 2021Quote: ... 0.2 µg DNA encoding GFP-tagged T-Plastin (WT or mutant) and 0.25 µL Lipofectamine2000 (Thermo Fisher Scientific), mixed in 20 µL OptiMEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: WT and mutant R248W p53 DNA binding domains (DBDs) were cloned using the Gateway system (Thermo Fisher Scientific). Genes for WT and R248W p53 DBDs were respectively amplified from the vector pCMV-Neo-Bam carrying WT and R248W p53 constructs ...
-
bioRxiv - Physiology 2020Quote: ... Individual fish identified as potential mutants by HRMA were further confirmed by Topo-TA cloning (Thermo Fisher Scientific) of the target locus ...
-
bioRxiv - Cancer Biology 2020Quote: ... Full-length EWS/FLI and mutants (all containing amino-terminal 3xFLAG-tags) were cloned into pMSCV-Hygro (Invitrogen) with sequence details provided in Additional file 1 ...