Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Genetics 2024Quote: ... human for rs2297550 from ThermoFisher.
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% (v/v) fetal calf serum (FCS) and 1% penicillin/streptomycin (Gibco). BT-549 and HCC1806 were cultured in Roswell Park Memorial Institute medium (RPMI ...
-
bioRxiv - Immunology 2021Quote: ... The signals were read at 450 nm using accuSkan FC microplate photometer (Fisher Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... Fab and Fc regions were separated using a Nab Protein A column (Thermo Scientific). Fabs were concentrated up to ~1 mg/mL using an Amicon Ultra 0.5 filter (10k cut-off ...
-
bioRxiv - Molecular Biology 2021Quote: ... SDM79 and SDM80 were supplemented with 7.5 mg/l hemin and 10% FCS (Invitrogen), and cells were grown at 27°C continuously in these media ...
-
bioRxiv - Immunology 2022Quote: ... and binding to Fc receptors was blocked using CD16/CD32 (clone 93, eBioscience/ThermoFisher). Cell numbers were calculated using counting beads (123count eBeads ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 10% FCS and 100 units/mL Penicilium and 100 μg/mL Streptomycin (Gibco). To generate overexpressing cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... DNA constructs for Fc-NKG2D molecules were expressed in Expi293TM cells (Thermo Fisher Scientific) and dimeric secreted protein was purified by Protein A affinity chromatography (PierceTM #20334 ...
-
bioRxiv - Physiology 2020Quote: ... The ELISA was read using a filter-based accuSkan FC micro photometer (Fisher Scientific). The limits of sensitivity were > 0.188 ng/ml and > 0.375 ng/ml for MUC5AC and MUC5B ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were blocked with an anti-Fc Receptor polyclonal antibody (Invitrogen 14-9161-73) for 30 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... point FCS measurements with Alexa Fluor® 488 (Thermo Fisher Scientific, Waltham, MA, USA) dissolved in water at 20 nM were performed at the same laser power ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 2% v/v heat-inactivated FCS and sodium bicarbonate (Gibco 25080-060). Diluted compounds were then mixed with EGFP-expressing Vero E6 cells at 25,000 cells/well in 96-well plates (Greiner Bio-One ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% fetal calf serum (FCS) and 1% of Penicillin-Streptomycin mixture (Gibco) at 37°C 5% CO2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... followed by incubation with HRP-conjugated goat anti-Fc antibody (Invitrogen, catalog number A18817). Stained cells were visualized using KPL TrueBlue peroxidase (SeraCare ...
-
bioRxiv - Immunology 2020Quote: ... Washing medium consisted of 2% FCS and 2% P/S in RPMI 1640 (Gibco). FACS buffer contained 2% FCS and 2mM EDTA in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance at 450 nm was read using an accuSkan FC microplate reader (Fisher Scientific) with SkanIt software (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed once with RPMI medium (Gibco, w/o glucose, FCS and PSG) and incubated in the same medium for 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% Fetal Calf Serum (FCS) and 1% Antibiotic Antimycotic (Gibco, Thermofisher, Netherlands) was added to each swab sample ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% Fetal Calf Serum (FCS) and 1% Antibiotic Antimycotic (Gibco, Thermofisher, Netherlands) was added to each swab sample ...
-
bioRxiv - Immunology 2022Quote: ... and pellet resuspended in 200uls MACS + Fc-block (ThermoFisher, catalog no. 14-9161-73). Cells were stained for surface antigens using fluorescence-conjugated monoclonal Abs specific to human CD45 ...
-
bioRxiv - Immunology 2022Quote: ... Fcs and IgGs were synthesized and cloned by GeneArt (Thermo Fisher Scientific, Waltham, MA) in the pcDNA3.4 expression vector and transiently expressed in HEK 293F cells ...
-
Werner syndrome helicase is a selective vulnerability of microsatellite instability high tumor cellsbioRxiv - Cancer Biology 2019Quote: ... with glutamax supplemented with 10% FCS and 10 µg/ml Blasticidin (Invitrogen, R210-01). HCT 116 _CRISPR-Cas9 cells were cultured like the parental cell line supplemented with 2 µg/ml Puromycin ...
-
bioRxiv - Cell Biology 2019Quote: ... and 10% FCS in culture dishes (100 mm with vents; Fisher Scientific UK Ltd) at 37°C in a humidified incubator at 5% CO2 ...
-
bioRxiv - Microbiology 2019Quote: ... containing 10% FCS and 100 units/ml penicillin-streptomycin solution (Pen/Strep, Gibco, Belgium). Virus culture and cytopathic effect-based virus neutralization assays (CPENT ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed and resuspended in FC buffer with goat-anti-mouse Alexa488 (Invitrogen; 1:400) for an additional 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 10% fetal calf serum (FCS, Biowaste) and 1% penicillin/streptomycin (Life Technologies).
-
bioRxiv - Synthetic Biology 2020Quote: ... Absorbance at 405 nm was recorded with Multiskan FC microplate photometer (Thermo Fisher Scientific). All shaking steps were conducted in Titramax 1000 (Heidolph Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... TβRII-Fc (124 kDa) and murine mAb 1D11 (150 kDa) (Thermo Fisher, Waltham, MA) were each captured on individual flow cells to 100-140 RU ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM L-Glutamine and 50 µm 2-Mercaptoethanol) with 10% FCS (all Gibco). Colon and caecal tissue were digested in an enzyme cocktail of 0.45 mg/ml collagenase V (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2019Quote: ... The ELISA was read using a filter-based accuSkan FC micro photometer (Fisher Scientific). The limits of sensitivity were <0.188 ng/ml and < 0.375 ng/ml for MUC5AC and MUC5B ...
-
bioRxiv - Microbiology 2021Quote: ... to remove clumps and 10 ml RPMI supplemented with 10% FCS (Thermo Fisher Scientific) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... Digestion was blocked by transferring the halves to a dish containing FCS (Gibco, USA) and the epidermis peeled off the dermis ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant hACE2-Fc protein was first biotinylated using EZ-Link Sulfo-NHS-Biotin (ThermoFisher) as the instruction described ...
-
bioRxiv - Immunology 2020Quote: ... Fc receptors were blocked prior to staining using anti-CD16/32 (93, ThermoFisher Scientific). Where >1 brilliant violet or brilliant UV dye was used concurrently ...
-
bioRxiv - Immunology 2022Quote: ... followed by Fc-receptor blockade with anti-CD16/CD32 (Thermo Fisher #14-0161-85), and then stained for 30 min on ice with the following antibodies in flow cytometry staining buffer (FACS) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 10% v/v foetal calf serum (FCS) (Thermo Fisher Scientific, Waltham, MA) and 1% v/v penicillin/ streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... to remove clumps and 10 ml RPMI supplemented with 10% FCS (Thermo Fisher Scientific) was added ...