Labshake search
Citations for Thermo Fisher :
3151 - 3200 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Protein transport inhibition in T-REx-293 cell culture was achieved by the application of 1 µl/ml BD GolgiPlug (Fisher Scientific), diluted in appropriate culture medium ...
-
bioRxiv - Molecular Biology 2022Quote: The stable cell line expressing HMGN5 (HMGN5-FlpIn) was created using the T-REx™-293 Flp-In system (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... HIV-1 Env and ELC07 Fab used for cryo-EM were produced by transient transfection of Expi293 cells with endotoxin-free preparations of recombinant plasmids using ExpiFectamine 293 (Fisher Scientific). To produce ELC07 Fab ...
-
bioRxiv - Immunology 2024Quote: ... a kind gift from Jason McLellan) was expressed by transiently transfecting transiently transfecting plasmid using FreeStyle 293-F cells (Thermo Fisher) using polyethyleneimine ...
-
bioRxiv - Bioengineering 2024Quote: ... A mixture of 15 μg of pcDNA3.4-V-gene-mIgG1 vector and 15 μg of pcDNA3.4-V-gene-kappa vector were transfected into Expi293 cells using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
Phospho-KNL-1 recognition by a TPR domain targets the BUB-1–BUB-3 complex to C. elegans kinetochoresbioRxiv - Cell Biology 2024Quote: ... elegans BUB-1 TPR (1-189)::3xFLAG under a CMV promoter was transfected into Freestyle 293-F cells (Thermo Fisher Scientific). 48 hours later ...
-
bioRxiv - Biochemistry 2023Quote: ... The generation of stable expression cell lines in WDR76 knockout background was similar to the stable transfection of Flp-In™-293 Cell Line described by manual (Invitrogen). All cell lines were maintained in DMEM medium with GlutaMAX ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell surface display DNA constructs for the SARS-CoV-2 G614 or its mutants or S2 together with a plasmid expressing blue fluorescent protein (BFP) were transiently transfected into Expi293F cells using ExpiFectamine 293 reagent (ThermoFisher Scientific) per manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... All fusion proteins were expressed in Expi-293F cells in 250-280 ml culture using the ExpiFectamine 293 Transfection Kit (Life Technologies) according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2023Quote: ... and human embryonic kidney 293 cells (HEK293) were purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Fisher Scientific, #MT10013CV) with 10% FBS at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: The Flp-In cell line expressing GFP-CENP-E2055-2608 was generated using HeLa T-REx Flp-In 293 cells according to the Flp-In system protocol (Thermo Fisher). GFP-CENP-E2055-2608 was cloned into pcDNA5 FRT/TO vector ...
-
bioRxiv - Microbiology 2023Quote: ... All plasmids used in this study were generated by ATUM Bio and transient transfection was carried out following the manufacturer’s protocol for the ExpiFectamineTM 293 transfection kit (Thermo Fisher Scientific). Four days after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... including Camuiα were transfected into HEK293S GnTI-cells (2 x 106 cells per well in 6-well plates) cultured in FreeStyle 293 (Thermo Fisher), using the TransIT2020 transfection reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmids were co-transfected into Expi293F cells at a 2:1 (HC:LC) mass ratio using ExpiFectamine 293 Reagent (Thermo Fisher Scientific). At 7 days post-transfection ...
-
bioRxiv - Biophysics 2023Quote: ... 400 μg of calmodulin and myosin-5 expression vectors (at a 1:6 ratio) were mixed with 15 ml FreeStyle 293 media (Thermo Fisher) and 1.2 ml of PEI (Polysciences ...
-
bioRxiv - Immunology 2023Quote: ... The plasmids were transiently co-transfected into Expi293F cells at a mass ratio of 2:1 (HC:LC) using ExpiFectamine 293 Reagent (Thermo Fisher Scientific). After transfection ...
-
bioRxiv - Bioengineering 2024Quote: ... were acquired directly from Thermo Fisher Scientific as an authenticated product maintained according to the manufacturer’s guidelines in either FreeStyle 293 Expression medium (Cat #12-338-018, Thermo Fisher Scientific) or HyClone CDM4HEK293 media (Cat # SH30859 ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmids were co-transfected into Expi293F cells at a 2:1 (HC:LC) mass ratio using ExpiFectamine 293 Reagent (Thermo Fisher Scientific) following the manufacturer’s protocol for a 25 mL culture ...
-
bioRxiv - Microbiology 2024Quote: HEK293S GnTI-(ATCC CRL-3022) suspension cells used for expression of HIV Env proteins were maintained in FreeStyle 293 expression medium (Life Technologies), supplemented with 1% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were co-transfected at a 1:2 heavy to light chain ratio into Expi293F cells using the Expifectamine 293 Expression Kit (Thermo Fisher), and antibodies were purified with protein A agarose (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...