Labshake search
Citations for Thermo Fisher :
2851 - 2900 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: RNA in 2X SuperScript III buffer was incubated for 1 min at 50 °C on a PCR cycler with 2.5 μl of the following mix: 1.5 μg Random Primer (Life Technologies 48190-011), 10 μM Oligo d(T ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR was carried out using predesigned PrimeTime qPCR Primers (IDT) and TaqMan Universal Master Mix II with UNG (Applied Biosystems), combined with cDNA samples in a 96-well PCR plate and run on a 7500 Fast Real–Time PCR system (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase Chain Reaction (PCR) primers for inserting different LacO sites and pLac were purchased from Integrated DNA Technologies (IDT) and Life Technologies (Thermo Fisher). GFP was obtained from pAKgfp1 (Addgene #14076) ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR and primer sequences were previously described (Kolmos et al., 2009) with following modifications: ABsolute Blue qPCR SYBR Green (ThermoFisher®) was used instead of iQ SYBR Green (Biorad) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 µL of the amplified product was subjected to another PCR reaction using primer pair AK4340F2 and AK4630R2 (Kapoor et al., 2013) along with the DreamTaq DNA Polymerase (ThermoFisher Scientific). The PCR conditions comprised of 3 min of denaturation at 95 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were analysed in triplicate with SYBR GREEN dye (Primer Design Precision Master mix) on an ABI StepOnePlus quantitative PCR instrument (Applied Biosystems). The comparative Ct method was employed to measure amplification of specific mRNAs vs ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM reverse internal control primer [5’-CTTGTTGAGAACAAACTCCTGCAGCT-3’] and Dream Taq Hot Start Green PCR Master Mix (Thermo Fisher Scientific). Cycling conditions were 3 min at 95°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The synthesized cDNA was amplified by EBNA 3C (1F and 1R) primers (5’-GAGAAGGGGAGC GTGTGTTGT-3’, 5’-GCTCGTTTTTGACGTCGGC-3’) by using regular PCR and adding Taq DNA polymerase (ThermoFisher, USA). The components of 25 μL reaction mixture contained 10 μL extracted DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1.25µl of gene specific primer (0.5µm from IDTDNA)] on a Step One Plus Real-Time PCR System (Applied Biosystems™, USA). PCR amplification was carried out at 95°C for 10s ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR products were sequenced in both directions using the same primers as used for PCRs in a 2720 Thermal Cycler (Applied Biosystems) with an initial 1-minute denaturation step at 96°C ...
-
bioRxiv - Microbiology 2020Quote: ... The genes of interest and pfhsp70-1LID- were PCR-amplified using specific primer pairs (SI Appendix, Table S1) and Platinum Taq DNA polymerase (ThermoFisher Scientific) (2 U/reaction) ...
-
bioRxiv - Microbiology 2020Quote: ... The rclR-lacZ and rclX-lacZ plasmids were constructed by PCR amplification of the upstream promoter DNA (117 bp) of rclR and rclX using primers in Table S1 and ligation into pCR™-Blunt (Invitrogen) for sequence-verification using M13F and M13R primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... from wild type tobacco plastome sequence flanking NarI restriction site were amplified by PCR using primers described in Table S1 and labeled with Biotin DecaLabel DNA Labeling Kit (Thermo Scientific). Therefore ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was quantified using real the Genesig® Real Time PCR Coronavirus COVID-19 (CE IVD) kit (Primer Design) using the manufacturer’s protocol and QuantStudio 5 Real-Time PCR System thermocycler (Thermo Fisher Scientific)
-
bioRxiv - Developmental Biology 2021Quote: ... 50 ng of genomic DNA from each strain was used as template in a PCR reaction with 0.5 μM of each primer (FP: AGGGTGTGAGTTTGCATGAGAGTG; RP: GGCTTTATGTGTCCTGCAGCAG) and PowerUp SYBR Green Master Mix (ThermoFisher Scientific, A25742). All reactions were ran in triplicates.
-
bioRxiv - Immunology 2021Quote: ... Primers were used at 200 nM in each 20 μl reaction with 1x Dreamtaq Green PCR Master Mix (Thermo Fisher Scientific). Cleaned PCR products were diluted at 1:10 and sequenced using Sanger sequencing (Elim Biopharm).
-
bioRxiv - Immunology 2021Quote: ... Primers were used at 200 nM in each 20 μl reaction with 1x Dreamtaq Green PCR Master Mix (Thermo Fisher Scientific). Cleaned PCR products were diluted at 1:10 and sequenced using Sanger sequencing (Elim Biopharm) ...
-
bioRxiv - Genetics 2020Quote: ... the human BBS2 ORF was PCR amplified with gene specific primers and sub-cloned into the pCDNA3.1V5/His TOPO TA vector (Invitrogen, Carlsbad, CA). The GeneArt Site-Directed Mutagenesis system (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and GAPDH were determined using sequence specific primers and Power SYBR® Green PCR Master Mix (Applied Biosystems, Part No. 4367659) for qRT-PCR ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was conducted using gene-specific primers (Table S6) and Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) on a Bio Rad CFX Connect Real-Time Detection System (Hercules ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed in technical triplicates using the Fast SYBR Green qPCR Mastermix with 250 μM of primer concentration (Applied Biosystems) on QuantStudio 6 (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... coding sequences of CMV MPs and CmVPS41s were PCR amplified using specific primers (Supplemental table 1) and cloned into plasmid pENTR/D-TOPO (Thermo Scientific by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative real time PCR reactions were prepared with sequence-specific primers with PowerUP™ Syber Green Master mix (Thermo Fisher Scientific) in a 20 uL volume ...
-
bioRxiv - Plant Biology 2022Quote: ... T-DNA insertion position was confirmed with gene-specific and T-DNA-specific primers (Supplemental Table 8) with Phire Plant Direct PCR Master Mix (Thermo Scientific) according to the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2022Quote: ... The cDNA fragment contained in each clone was PCR amplified using gene specific primer pairs and the Platinum SuperFi II mastermix (Invitrogen™, ThermoFisher) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the resulting solution was used to perform multiplex PCR using primer pairs specific for each endogenous plasmid of strain B31 [61] and the DreamTaq Green DNA Polymerase (Thermo Scientific). For genomic DNA extraction ...
-
bioRxiv - Neuroscience 2022Quote: ... Zebrafish genotypes were determined by incubating fin-clip lysate with indel-primers (Table 1) and DreamTaq PCR Master Mix (Thermo Scientific) at 95°C (3 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... successful removal of the CapR cassette was confirmed by PCR using ‘KO-Ver’ primers and DreamTaq polymerase (Thermo Scientific, Dreieich, Germany).
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 2× and used for real-time PCR with gene-specific primers in the presence of PowerUp SYBR Green Master Mix (Life Technologies) by QuantStudio 6 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... Purified ChIP DNA samples and the inputs were subjected to amplification with specific primers using ABI StepOne plus a real-time PCR machine (Applied Biosystems).
-
bioRxiv - Neuroscience 2022Quote: ... qPCRs were performed in triplicate with 30 ng of cDNA and a master mix of exon-spanning primers (Supplementary Table 1) and PerfeCTa SYBR Green FastMix ROX (QuantaBio, MA) on an QuantStudio real-time PCR analyzer (Invitrogen, MA), and results were expressed as fold change (2-ΔΔCt ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4.75 μL of nuclease-free water and 400 nM of each primer or by adding 1 µl of yeast lysate to 5 µl of DreamTaq Green PCR Master Mix (2X) (ThermoFisher Scientific) plus 4 µL of nuclease-free water with 200 nM of each primer ...
-
bioRxiv - Microbiology 2024Quote: ... adapters were ligated to the amplicons in a PCR reaction using the P5 and P7-bearing adapter primers and the Phusion High-Fidelity DNA Polymerase kit (Thermo Scientific). Amplicons were sized and purified using an AmpurXP magnetic bead capture (Agencourt) ...
-
bioRxiv - Microbiology 2024Quote: ... The dsDNA fragments were amplified in a PCR reaction with the 454-E primer and the Phusion High-Fidelity DNA Polymerase kit (Fisher Scientific). Amplicons were purified with the NucleoSpin gel and PCR Clean-up (Macherey-Nagel).
-
bioRxiv - Cell Biology 2024Quote: ... Diluted cDNA was used together with selected primer pairs and Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific, #4368702) on a ViiA7 device (Applied biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed using TaqMan reagents and primer-probes (Applied Biosystems, Foster City, CA). Gene expression was normalized to the control gene TATA box binding protein (Tbp).
-
bioRxiv - Plant Biology 2024Quote: ... were amplified from wild-type Tak-1 genomic DNA using PCR with the appropriate primer pairs (Table S1) and cloned into the pENTR/D-TOPO cloning vector (Life Technologies). These entry vectors were used in the Gateway LR reaction (Life Technologies ...
-
bioRxiv - Immunology 2024Quote: ... and vapA specific TaqMan™ primer and probe (Forward: GAGCAGCAGTACGACGTTCA; Reverse: GGCCCGAATACGTGAAACCT; Reporter: CAGCGCGGTCGTCTAC) in the instrument QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2023Quote: ... The full 16S rRNA gene was amplified by PCR from each well with primers 27F and 1492R (38) (IDT, Coralville, Iowa, USA) and DreamTaq polymerase (Thermo Scientific). PCR purification and Sanger sequencing of all amplicons using the same primers was done at the UC Berkeley DNA Sequencing Facility ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... was used to assess the number of cycles necessary to amplify libraries to the concentration needed for sequencing by amplifying 1 uL of library with LabTAQ Green Hi Rox master mix (Labtech) and adapter-targeted primers on a StepOnePlus Real-Time PCR system (Thermofisher Applied Biosystems). Indexing PCR involved double indexing (Kircher et al ...
-
bioRxiv - Genetics 2024Quote: ... DNA fragments were cycle-sequenced with one of the PCR primers using the BigDye Termintor v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific). Resulting PCR products were purified with the Bioanalysis NucleoSEQ Kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR reactions were prepared with sequence-specific primers (Integrated DNA Technologies, idtdna.com) with Power SYBR Green PCR Master Mix (Applied Biosystems, 4367659). RT-qPCR was performed using a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Each segment of the LACV genome was amplified utilizing primers specified in Table 5 and a Phusion High-Fidelity PCR Master Mix Kit with HF Buffer (Thermo Scientific). All LACV segments were confirmed by a 1% agarose gel and sent to Sanger sequencing using the primers in Table 5 at Genewiz (South Plainfield ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µL of primers (final concentration 200 nM) and 6 µL of Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). The amplification conditions included an initial incubation for 2 min at 50°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was diluted 1:50 in H20 and mixed with 10μM primers and PowerSYBR Green PCR Master Mix (Applied Biosystems, #4367659). Samples were normalized to ribosomal protein rp49 transcript levels ...
-
Small Molecule Screen Identifies Pyrimethamine as an Inhibitor of NRF2-driven Esophageal HyperplasiabioRxiv - Cancer Biology 2022Quote: ... qPCR was performed to quantify the expression levels of genes of interest with relevant primers and TaqMan probes in a 96-well optical plate on an ABI 7900HT Fast Real-Time PCR system (Applied Biosystems).
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA or cDNA were mixed with primers (see Supplementary Table 5) and Applied Biosystems Power SYBR Green PCR Master Mix (Thermo Scientific) in a Microamp EnduraPlate Optical 384 Well Clear Reaction Plate (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... the pK18mobsacB suicide plasmid57 (GenBank accession: FJ437239) was PCR linearized (primers FDE234 and FDE235) with Phusion Taq polymerase (F-5305, Thermo Scientific); 750 bp of upstream (primers FDE278 and FDE279 ...
-
bioRxiv - Immunology 2023Quote: ... and 500 nM each of the forward primer and reverse primer (Table 3) with the following cycling conditions on either QuantStudio 3 or 5 Real-Time PCR systems (Applied Biosystems): 95°C for 2 min ...
-
bioRxiv - Immunology 2023Quote: ... cDNA from samples was mixed with QuantiTect probe PCR master mix and gene-specific primers to run on a QuantStudio 6 Flex real-time cycler (Applied Biosystems). To generate a control for the amplification reaction ...