Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The relative fold change in gene expression was determined using the 2-ΔΔCt method ...
-
bioRxiv - Cancer Biology 2023Quote: qPCR was performed with StepOnePlus Real-Time PCR Systems (Applied Biosystems) in a reaction volume of 20μl containing 5μl of diluted cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or a Quant Studio 3 Real-Time PCR system (Applied Biosystems) apparatus ...
-
bioRxiv - Immunology 2023Quote: ... Data acquisition with StepOne Plus real time PCR system (Applied Biosystems) and relative mRNA expression was calculated by 2-ΔΔCT method.
-
bioRxiv - Biochemistry 2023Quote: ... and the QuantStudio3 Real-Time PCR System (ThermoFisher, Whaltam, MA, USA) as previously described (Aquilano et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... using the StepOnePlus 96-well Real-Time PCR System (Applied Biosystems). Reactions with cDNA sample were carried out in a total volume of 20 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a ViiA 7 Real-Time PCR system (AB Applied Biosystems) utilizing specific primers at a concentration of 1 µM ...
-
bioRxiv - Physiology 2023Quote: ... in a 7500 Applied Biosystems Real-time PCR machine (Applied Biosystems). For each sample ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... using StepOne Plus Real-Time PCR System (Applied Biosystems, Darmstadt, Germany). To normalize mRNA expression ...
-
bioRxiv - Neuroscience 2023Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) qPCR primers are listed in Table S3.
-
bioRxiv - Bioengineering 2023Quote: ... and the equipment StepOne Plus real-time PCR system (Applied Biosystems) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The reverse-transcription was conducted at a temperature of 45 °C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... on a StepOne Real-time PCR System (Applied Biosystems, Darmstadt, Germany). For virus quantification ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Step One Plus Real-Time PCR System (Applied Biosystems) and the following TaqMan primer sets ...
-
bioRxiv - Systems Biology 2023Quote: ... using QuantStudio 5 Real-Time PCR System (Thermo Fisher, Waltham, MA). The first sequencing was performed on NextSeq 2000 sequencer (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific). The 2-ýCt method was used to analyze the data using glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Bioengineering 2023Quote: ... Analysis was performed by 7900HT Real Time PCR System (Applied Biosystems) and the Sequence Detection System (SDS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The qRT-PCR program was as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... Assays were run on 7500 Real Time PCR System (Applied Biosystems). Small nucleolar RNA (Z30 ...
-
bioRxiv - Molecular Biology 2023Quote: ... StepOnePlus Real-Time PCR System was used (Thermo Fisher Scientific, USA). The thermal cycle used was 10 min for pre-denaturation ...
-
bioRxiv - Genomics 2023Quote: ... real-time quantitative PCR was performed in ABI 7500 (Applied Biosystems) with the use of the following primers and probes:
-
bioRxiv - Microbiology 2023Quote: ... using a 7900 HT Fast Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Cell Biology 2023Quote: ... in triplicates on ViiA 7 Real-Time PCR System (Applied Biosystems). Relative gene expression was calculated using the comparative Ct method with normalization to 36B4 as internal control ...
-
bioRxiv - Cell Biology 2023Quote: ... SYBR Green and StepOne plus real-time PCR machine (Applied Biosystems) were used in real-time PCR studies ...
-
bioRxiv - Genomics 2023Quote: Details of TaqMan® real-time PCR assays obtained from ThermoFisher Scientific.
-
bioRxiv - Bioengineering 2023Quote: ... Real-time PCR was performed using the StepOnePlus thermocycler (Applied Biosystems) and SYBR Green Reaction Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a StepOnePlus real-time PCR system (Applied Biosystems, MA. USA). Primer designs are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative real-time PCR was performed with Taq DNA polymerase (Invitrogen) and SYBR Green I (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... on an ABI QuantStudio 7 Real-Time PCR machine (Applied Biosystems). A custom TaqMan probe for the skipped Dmd product (Thermo Fisher ...
-
bioRxiv - Physiology 2023Quote: ... in QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, USA). Relative gene expression levels were quantified against the housekeep genes Tbp or L19 messages and normalized to those of control islets or HUVECs respectively ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on Applied Biosystems® 7500 Real-Time PCR System (Life Technologies). mtDNA was detected using primers MT16520F and MT35R ...
-
bioRxiv - Microbiology 2023Quote: ... on a QuantStudio 12K Flex Real-Time PCR System (Life Technologies) with primers targeting the human genome or the viral genome (human B2M-F ...
-
bioRxiv - Immunology 2023Quote: ... and measured on a ABI7300 Real-Time PCR system (Applied Biosystems) in duplicates in 96-well plates ...
-
bioRxiv - Microbiology 2023Quote: ... and the Quantstudio 7 Flex real-time PCR system (Applied Biosystems). Fold change in mRNA levels was calculated using the delta-delta comparative threshold cycle (Ct ...
-
bioRxiv - Microbiology 2023Quote: ... on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems, USA). No amplification was observed for no-template control in qPCR reaction (CT value above 35) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... in triplicates using the StepOnePlus real-time PCR system (Applied Biosystems) and 10 ng cDNA template ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... on an ABI StepOne Plus Real-time PCR System (Applied Biosystems). Ten ng of total RNA were loaded and samples were normalized to expression of cdc-42.
-
bioRxiv - Cell Biology 2023Quote: ... Primers for real time PCR were obtained from Invitrogen (Vienna, Austria).
-
bioRxiv - Cell Biology 2023Quote: ... and the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2023Quote: ... on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific), as described previously (68) ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio™ 5 Real-Time PCR machine (Applied Biosystems) with primers targeting miR-451a (QIAGEN ...
-
bioRxiv - Plant Biology 2023Quote: ... and run in StepOne Real-Time PCR System (Applied Biosystems, USA). The qRT-PCR conditions used were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... on the AB 7500 FAST Real Time PCR platform (Applied Biosystems) and primers to the WPRE element ...
-
bioRxiv - Neuroscience 2024Quote: ... on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). Genotypes were determined based on single nucleotide polymorphism rs429358 that defines ε3 and ε4 alleles of human APOE (Assay ID C_3084793_20 ...
-
bioRxiv - Physiology 2024Quote: ... on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) with specific primers for each gene ...
-
bioRxiv - Neuroscience 2024Quote: ... or Quant Studio 6 Pro Real-Time PCR System (Applied Biosystems). TaqMan assay details are listed in Tab ...
-
bioRxiv - Plant Biology 2024Quote: ... on a StepOne Plus Real-Time PCR system (Thermo Fisher Scientific). Relative transcript levels were determined using the 2-ΔΔCt method 45 by normalisation against EF1α as internal control as well as against the respective biological control ...
-
bioRxiv - Bioengineering 2024Quote: ... with StepOne Plus™ Real-Time PCR System (4376598, Applied Biosystems). Gene expression data was analysed via the web-based hPSC Scorecard™ analysis software.