Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... on an ABI StepOnePlus Real-Time PCR System (Thermofisher Scientific, USA) with the following program ...
-
bioRxiv - Microbiology 2021Quote: ... and a QuantStudio 6 Flex Real-Time PCR machine (Applied Biosystems). Reactions were performed in a final volume of 10 μL including 1 μL undiluted cDNA sample and 500 nM of each primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative real-time PCR was performed in a QuantStudio 6flex (ThermoFisher) using PowerUp SYBR Green Master (ThermoFisher) ...
-
bioRxiv - Immunology 2020Quote: ... run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed using StepOnePlus Real-Time PCR System (Applied Biosystems). Transcript abundance relative to GAPDH was calculated using delta-delta CT.
-
bioRxiv - Developmental Biology 2020Quote: ... on Applied Biosystems QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for N=3 biological replicates ...
-
bioRxiv - Immunology 2021Quote: ... and measured on StepOnePlus Real-Time PCR System (Applied Biosystems, 4376600). Data were normalized to 18S rRNA.
-
bioRxiv - Cell Biology 2021Quote: ... Real Time PCR was performed with a StepOne system (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... with the QuantStudio-7flex Real-Time PCR system (Thermo Fisher Scientific). Equimolar pools of sequencing libraries were sequenced using S4 flow cells in a Novaseq 6000 sequencer (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and a QuantStudio 6 Flex real-time PCR system (Life Technologies) were used to perform real-time quantitative PCR ...
-
Tuning Cell-free Composition Controls the Time-delay, Dynamics, and Productivity of TX-TL ExpressionbioRxiv - Synthetic Biology 2021Quote: ... and run in a StepOnePlus Real-Time PCR System (Applied Biosystems). Melting curve analysis was performed to confirm product homogeneity ...
-
bioRxiv - Cell Biology 2022Quote: ... Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies), we measured relative amounts of specific mRNAs with SYBR green as the fluorescent dye ...
-
bioRxiv - Physiology 2022Quote: ... with StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA).
-
bioRxiv - Biochemistry 2022Quote: ... and incubated in a StepOnePlus Real-time PCR System (Applied Biosystems) at 37 °C for variable time ...
-
bioRxiv - Cell Biology 2022Quote: ... using the ABI Q5 Real Time PCR System (Applied Biosystems, USA). All primers for qRT-PCR were listed in Supplemental Table 3 ...
-
bioRxiv - Genetics 2022Quote: ... using ΔΔCT method on StepOne Plus Real-Time PCR machine (ThermoFisher). We used eef1l1 for normalization ...
-
bioRxiv - Immunology 2022Quote: ... and a StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA). The total mRNA copy number was quantified using a standard curve prepared with serial dilutions of the pGEM-T vector containing a partial nucleocapsid gene of SARS-CoV2.
-
bioRxiv - Microbiology 2022Quote: ... on a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The QuantStudio™ 1 Plus real-time PCR system (Thermo Fisher) was used to control the temperature increasing from 25 °C to 99 °C with an increment of 0.5 °C and to monitor the fluorescence (excitation ...
-
bioRxiv - Neuroscience 2022Quote: ... using a 7900 HT Fast Real-Time PCR System (Applied Biosystems). The amplification signals were detected in real time ...
-
bioRxiv - Molecular Biology 2023Quote: ... on the QuantStudio real-time PCR system (Applied Biosystems, Carlsbad, CA) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... on a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, USA). Candida strain ...
-
bioRxiv - Plant Biology 2022Quote: ... on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) with standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... and a QuantStudio 6 Flex Real Time PCR system (Thermo Fisher) using RNA pol2 as an internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are indicated in Appendix Table 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... in a StepOne Real-Time PCR system (Applied Biosystems, Warrington, UK) under the cycling conditions ...
-
bioRxiv - Physiology 2022Quote: ... in a Quant Studio 5 Real-Time PCR System (Applied Biosystems, ThermoFischer Scientific AG ...
-
bioRxiv - Neuroscience 2022Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Applied Biosystems). qPCR results comparing the injected and uninjected hemispheres were analyzed using the ΔΔCT methods and normalized to Actb ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR was performed with QuantStudio™ 5 (Thermo Fisher).
-
bioRxiv - Neuroscience 2022Quote: ... and run on a StepOnePlus Real-Time PCR System (Applied Biosystems). Primer sequences used for Neil3 were GGGCAACATCATCAAAAATGAA forward and CTGTTTGTCTGATAGTTGACACACCTT reverse ...
-
bioRxiv - Microbiology 2022Quote: ... using the QuantStudio™5 Real-Time PCR system (Applied Biosystems), which has been described in detail (31) ...
-
bioRxiv - Microbiology 2022Quote: ... and the Applied Biosystems 7300 Real-Time PCR system (Thermo Fisher). The thermal profile was 95 °C for 30 s ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we performed a qPCR (Thermo Scientific PikoReal Real-Time PCR System). Extraction and library blanks were run alongside all samples to check for the presence of contamination ...
-
bioRxiv - Physiology 2022Quote: ... with the QuantStudio 6 Flex Real-Time PCR system (Thermo Scientific).
-
bioRxiv - Developmental Biology 2022Quote: ... and QuantStudio™ 3 Real-Time PCR System (Applied Biosystems A28567). All primers used in qRT-PCR had primer efficiencies above 98% ...
-
bioRxiv - Molecular Biology 2024Quote: ... on a 7900HT Real-Time PCR instrument (Thermo Fisher Scientific, 10966). The housekeeping gene Actb was used as the reference ...
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). The data were normalized using actin (Solyc11g005330 ...
-
bioRxiv - Biochemistry 2024Quote: ... in a Quantstudio 12K Flex real time PCR system (Applied Biosystems). Primers used for RT-PCR are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific). Standard cycling parameters were used ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... QuantStudio™ 6 flex Real-Time PCR System (Applied Biosystems: 4485691).
-
bioRxiv - Molecular Biology 2024Quote: ... in StepOneTM or ViiATM 7 Real-Time PCR Systems (Applied Biosystems). All PCR reactions were done with technical duplicates or triplicates and then normalized to the GAPDH housekeeping gene ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... Assays were run on StepOnePlus Real-Time PCR system (Applied Biosystems). Tcp1 was used for input and differentiation stage normalization ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Step One plus Real-time PCR system (Applied Biosystems).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the Step One Plus Real-Time PCR System (Applied Biosystems). Relative quantification was achieved by normalizing to the expression levels of Beta-2-Microglobulin (B2m ...
-
bioRxiv - Neuroscience 2024Quote: ... A ViiA™ 7 Real-Time PCR System (Applied Biosystems. USA) was used to perform RT-qPCR ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... on an ABI StepOne Plus Real-time PCR System (Applied Biosystems). Ten ng of total RNA were loaded and a standard curve was used to quantify OrV ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems). Relative mRNA abundance in different time points were normalized to time points 0 hr (2-(△Ct −△Ct0) ...
-
bioRxiv - Cell Biology 2024Quote: ... performed via the ABI StepOnePlus Real-Time PCR System (Life Technologies), preceded the initiation of the sequencing process ...