Labshake search
Citations for Thermo Fisher :
2451 - 2500 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... on a Step One Plus Real-Time PCR system (Applied Biosystems). The primer and probe sequences were ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are indicated in Appendix Table 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... performed via the ABI StepOnePlus Real-Time PCR System (Life Technologies), preceded the initiation of the sequencing process ...
-
bioRxiv - Bioengineering 2023Quote: ... using Real-Time PCR (Polymerase Chain Reactions) System (ThermoFisher Scientific, Australia). A list of primers (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed using TaqMan assays (Thermo Fisher Scientific) on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). The data were normalized using actin (Solyc11g005330 ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific). Standard cycling parameters were used ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... on an ABI StepOne Plus Real-time PCR System (Applied Biosystems). Ten ng of total RNA were loaded and a standard curve was used to quantify OrV ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems). Relative mRNA abundance in different time points were normalized to time points 0 hr (2-(△Ct −△Ct0) ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Microbiology 2024Quote: ... with the 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2024Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The primers are listed in Supplemental Table 3 ...
-
bioRxiv - Immunology 2024Quote: ... and the StepOnePlus Real-Time PCR system (Thermo Fisher, Waltham, MA) was utilized for measurement ...
-
bioRxiv - Bioengineering 2023Quote: ... Assays were run in StepOne Real-time PCR systems (Applied Biosystems) using the following program ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... QuantStudio™ 6 flex Real-Time PCR System (Applied Biosystems: 4485691).
-
bioRxiv - Biochemistry 2024Quote: ... in a Quantstudio 12K Flex real time PCR system (Applied Biosystems). Primers used for RT-PCR are listed in Table S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed with the SYBR GreenER SuperMix (Invitrogen) on the QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... using a 7500 Fast Real-Time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific). The 2- ΔCt method was used to analyze the data using GAPDH and tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real time quantitative PCR was performed (Cat. No. 4385610, Applied Biosystems), and target gene transcript expression was normalized to Rn18s using the ΔΔCT method ...
-
bioRxiv - Plant Biology 2023Quote: ... via a Real-Time PCR System (ABI StepOnePlus, Applied Biosystems, USA). Primers for qRT-PCR were designed using Primer Prime Plus 5 Software Version 3.0 (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, A28567). Primers for Nos2 and B2m were designed using NCBI PrimerBlast84 ...
-
bioRxiv - Immunology 2023Quote: ... on the ABI 7900 Real-Time PCR system (Thermo Fisher Scientific). The primers sequences are listed in Table S1.
-
bioRxiv - Immunology 2023Quote: ... using QuantStudioTM 7 Flex Real-Time PCR System (Applied Biosystems, USA). The quantitative Polymerase Chain Reaction (qPCR ...
-
bioRxiv - Immunology 2023Quote: ... and the QuantStudio Flex Real-Time PCR System (Applied Biosystems, 4485701). Fold-changes relative to WT H1 hESCs were calculated using the delta-delta Ct method and normalized using the housekeeping gene GAPDH and experimental error was calculated through standard deviation (33) ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a QuantStudioTM 5 Real-time PCR system (Thermo Fisher Scientific) and analysed using QuantStudio™ 5 Design & Analysis Software ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a ViiA 7 Real-Time PCR system (Thermo Fisher Scientific) at 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a QuantStudioTM 6 Flex Real-Time PCR system (Applied Biosystems® ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems) using the default run program ...
-
bioRxiv - Microbiology 2023Quote: ... with the 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... on the QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems). The fold change was calculated using the 2^(−ΔΔCt ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Step One Plus Real-Time PCR machine (Applied Biosystems). The following program was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a 7900HT Fast Real-Time PCR System (Applied Biosystems, USA), using cycling parameters as recommended by the mastermix manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... a QuantStudio™ 6 Flex real-time PCR system (Applied Biosystems). Target transcript levels were normalized to those of the indicated reference genes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was performed using a StepOnePlus system (Applied Biosystems) with a TaqMan Gene Expression Assay (20× ...
-
bioRxiv - Cell Biology 2023Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... running in the 7500 Fast Real-Time PCR System (Applied Biosystems). When performing SYBR Green qPCR assays ...
-
bioRxiv - Microbiology 2023Quote: ... and speA using a Real time PCR System (Thermo Fisher Scientific) [3] and expression data normalized to that of housekeeping gene proS using a standard curve method as described previously [27].
-
bioRxiv - Neuroscience 2023Quote: ... CA) on a QUANTSTUDIO 5 Real Time PCR machine (Applied Biosystems). Samples were assayed in duplicate in one run (40 cycles) ...
-
bioRxiv - Plant Biology 2023Quote: ... using 2× SYBR Green Real-Time PCR Master Mix (Applied Biosystems). The three-step cycling program was as follows ...
-
bioRxiv - Physiology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). In mouse samples ...
-
bioRxiv - Immunology 2023Quote: ... using a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems) (Glasgow) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... using the QuantStudioTM 5 Real-Time PCR system (Thermo Fisher Scientific) and the PowerUpTM SYBRTM Green Master Mix (Themo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... Reactions were run on StepOnePlus Real-Time PCR System (Applied Biosystems) using the following cycling program ...
-
bioRxiv - Cell Biology 2023Quote: ... in triplicates on ViiA 7 Real-Time PCR System (Applied Biosystems). Relative expression levels were determined using the comparative Ct method with normalization to 36B4 as internal control ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7500 fast real-time PCR system (Applied Biosystems, Foster City, CA) was used to carry out quantitative PCR analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The Tbp mRNA was used as a loading control ...
-
bioRxiv - Cell Biology 2023Quote: ... Reactions were analysed with ViiA 7 Real-Time PCR System (Thermofisher) using the following cycle conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time quantitative PCR was performed with SybrGreen reagents (Applied Biosystems) on a LightCycler 480 instrument (Roche Life Sciences) ...