Labshake search
Citations for Thermo Fisher :
2751 - 2800 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were then read by 7500 Real-Time PCR System (Applied Biosystems) using the standard cycling mode ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed on StepOnePlus™ Real-Time PCR System (Thermo Fisher), and PerfeCTa SYBR green Fastmix (Quantabio ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems) instrument using KAPA SYBR FAST qPCR Kit (KapaBiosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... and expression was determined by StepOne Real-Time PCR System (Applied Biosystems). qPCR primer sequences are listed in Table S3.
-
bioRxiv - Cell Biology 2020Quote: ... Experiments were performed using a StepOnePlus Real-Time PCR System (Applied Biosystems). poly(A)-mRNA was isolated using Ambion® Poly(A)Purist™ MAG Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Arrays were run on the 7300 Real Time PCR System (Life Technologies) with the cycling profile (40 cycles) ...
-
bioRxiv - Cell Biology 2020Quote: ... The StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) was used for RT-qPCR.
-
bioRxiv - Cell Biology 2020Quote: ... Real-time quantitative PCRs were performed following the PowerUp SYBR Green (ThermoFisher) manufacturer instructions ...
-
bioRxiv - Genetics 2021Quote: ... on an Applied Biosystems 7500 Real-time PCR System (Thermo Fisher Scientific) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... in an Applied Biosystems 7.500 Real-Time PCR System (Thermo Fisher Scientific). A control without a template was included in all batches and α-tubulin was used as reference ...
-
bioRxiv - Developmental Biology 2021Quote: ... and measured on an QuantStudio 3 Real-Time PCR system (Applied Biosystems). mRNA abundance was calculated on three biological replicates of ten larvae ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2020Quote: ... MA) and processed with ABI StepOne Real-time PCR system (Applied Biosystems).
-
bioRxiv - Developmental Biology 2020Quote: ... qPCR was performed using the StepOne real-time PCR system (Applied Biosystems) with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... and 5μl of each sample was added to each RT-qPCR reaction that were amplified using iTaq Universal SYBR Green Supermix from Bio-Rad and read on a StepOnePlus Real-Time PCR System from Applied Biosystems. Gene expression levels were normalized to Gapdh and changes were determined relative to control cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on a 7500 Fast Real-Time PCR System (Applied Biosystems, CA, U.SA.). The expression level of each gene was calculated using the ΔCt method and normalized against L19 housekeeping gene ...
-
bioRxiv - Pathology 2022Quote: ... The real-time PCR data were analyzed with QuantStudio Software (Applied Biosystems). Results were calculated using the delta delta CT method ...
-
bioRxiv - Microbiology 2022Quote: ... or the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Massachusetts, USA) with the following primers against SARS-CoV-2 non-structural protein 14 (nsp14) ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was conducted using QuantStudio 3 Real-Time PCR System (Applied Biosystems) with Power SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative real-time PCR was performed using SYBR Green (Thermo Fisher Scientific), 2 μl cDNA and 1 μM each of the following oligonucleotides for rickettsial citrate synthase gene (gltA ...
-
bioRxiv - Neuroscience 2021Quote: ... in the Applied Biosystems QuantStudio 5 Real-Time PCR System (ThermoFisher Scientific). All reactions were run in triplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, USA). For this ...
-
bioRxiv - Molecular Biology 2021Quote: ... was performed and analysed on StepOnePlusTM real-time PCR system (Applied Biosystems). FLSMN2 and Total SMN2 transcripts were amplified using gene-specific primers (Table S1)(62) ...
-
bioRxiv - Neuroscience 2021Quote: ... and run on a QuantStudio 3 Real Time PCR System (Applied Biosystems). mRNA expression levels were normalized to the expression level of chicken 18S ribosome (Himmels et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... on a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems). Transcript levels were analyzed using the delta delta Ct method and GAPDH was used as an internal control (110) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and quantification by the Step One Real-time PCR system (Applied Biosystems). RT2 lncRNA PCR assays (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Amplification data were exported from QuantStudio Real-Time PCR Software (ThermoFisher Scientific) into Excel (version 16.0.11325.20156 ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Microbiology 2020Quote: ... in a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, USA). The standard curve was constructed using RNA from SARS-CoV-2 infected Vero E6 cells ...
-
bioRxiv - Genomics 2020Quote: ... and the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). RNA samples were multiplexed at a sequencing depth of five libraries per lane ...
-
bioRxiv - Molecular Biology 2021Quote: ... on a QuantStudio™ 5 Real-Time PCR System machine (ThermoFisher Scientific). Each value was normalized by the corresponding input chromatin sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed on a StepOnePlus real time PCR system (Applied Biosystems) using SYBR Green Mastermix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: We used QuantStudio Real-Time PCR Software version 1.3 (Thermo Fisher Scientific) for data analysis ...
-
bioRxiv - Neuroscience 2019Quote: ... and the the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Specific amplification was determined by melt curve analysis and agarose gel electrophoresis of the PCR products ...
-
bioRxiv - Physiology 2019Quote: ... on a Viia7 Real-Time PCR system (Life Technologies/Thermo Fisher Scientific), and normalized to 18S rRNA signals ...
-
bioRxiv - Physiology 2019Quote: ... on a Viia7 Real-Time PCR system (Life Technologies/Thermo Fisher Scientific), and normalized to 18S rRNA signals ...
-
bioRxiv - Pathology 2019Quote: ... and the QuantStudio3 Real-Time PCR System (Thermo Fisher, Whaltam, MA, USA) as previously described (Aquilano et al. ...
-
bioRxiv - Physiology 2019Quote: Using the StepOnePlus Real-time PCR System (Applied Biosystems, Waltham, MA, USA) and SYBR Green ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Data were acquired using a Quantstudio3 Real-Time PCR System (Applied Biosystems) using the following conditions ...
-
bioRxiv - Physiology 2020Quote: ... using an Applied Biosystems QuantStudio 3 real-time PCR system (ThermoFisher Scientific) as we previously described 66 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and deposited in a 7900HT Fast Real-Time PCR system (Applied Biosystems) to perform first strand cDNA synthesis (temperature program ...
-
bioRxiv - Microbiology 2019Quote: Amplification was measured on a StepOnePlus Real-Time PCR System (Applied Biosystems). Quantification of gDNA abundance relative to the standard curve was performed using the ΔCT method.
-
bioRxiv - Physiology 2020Quote: ... cDNA was amplified by real-time PCR using SYBR Green (Applied Biosystems) detection with specific primers for the gene of interest ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Bioengineering 2021Quote: ... in an Applied Biosystems StepOnePlus Real-Time PCR Machine (Thermo Fisher Scientific). Commercial primer pairs were used for GJA1 (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... on an Applied Biosystems 7500 Real-time PCR System (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... STEP ONE PLUS Real Time PCR system (Applied Biosystems Japan, Tokyo, Japan), SYBR GREEN PCR Master Mix (Applied Biosystems Japan ...