Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... with 5% heat inactivated Fetal bovine serum (HI-FBS) (Gibco). 1 million cells per 100 μl per sample were stained with anti-Flag antibody (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5% human serum and 5% AlbuMAX-II (Gibco)) was replaced daily until reaching maturity at day 14-post induction ...
-
bioRxiv - Immunology 2021Quote: ... His tag) (BLPSN-0986P, BETA Life Sciences, Fairfield, NJ, USA) was immobilized on a 96-well plate (442404, MAXISORP F96 NUNC Immuno-plate ...
-
bioRxiv - Cell Biology 2022Quote: MUTZ-3 cells (DSMZ) were cultured at 37°C in alpha-MEM (Life Technologies) supplemented with 20% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... the strips were washed 3 times in PBS-T before incubation in primary antibody (GST Tag Mouse anti-Tag, Clone: 8-326, Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... PKC-specific custom siRNA targeting to endogenous human PKCα (5’-CAGAAGAACTGTATGCAAT-3’) was purchased from Ambien (ThermoFisher). To perform knockdowns ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-CAGAGTCGATCAGTCTGCATATCTCCA-3’) with the dilution protocol of the Phusion Human Specimen Direct PCR Kit (Thermo Scientific). The PCR product was sequenced directly with a nested sequencing primer (5’-GGTGCTCTCCCGGGTACACAA-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... rKLK10 with a 6x C-terminal His tag was affinity purified using HisPur Ni-NTA Resin (Thermo Scientific) per the manufacturer’s instruction (Figure S16 ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (ACE2, dilution 1:100; TMPRSS2, 1:500; CD147, 1:500; 6x-HIS-tag (Invitrogen MA1-21315), 1:1000 ...
-
bioRxiv - Immunology 2019Quote: ... and human/mouse TGF beta 1 ELISA Ready-SET-Go! Kit (2nd Generation; Affymetrix, eBioscience), respectively ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Neuroscience 2021Quote: ... iMD3 cells were growth in 5%KSR medium (Alpha-MEM (12571-063, Gibco); 5% KSR (10828028 ...
-
bioRxiv - Developmental Biology 2023Quote: ... coated with 3 µg of HA-Tag monoclonal antibody (#26183, ThermoFisher Scientific) at 4°C for overnight ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2021Quote: ... β1 integrin/CD29 (Fisher Scientific; cat #: BDB555442), and cleaved caspase 3 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-β1 integrin (ThermoFisher Scientific, #PA5-78028), anti-GAPDH (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... and a6 integrin (ThermoFisher: #14-0495-82) were used to disrupt integrin signaling in the presence of SEMA7A or as antibody alone controls to determine off-target effects ...
-
AGS3 antagonizes LGN to balance oriented cell divisions and cell fate choices in mammalian epidermisbioRxiv - Developmental Biology 2022Quote: ... β4-integrin (rat, ThermoFisher 553745, 1:1,000), Cytokeratin-14 (chicken ...
-
bioRxiv - Cell Biology 2019Quote: ... α4-integrin (rat, ThermoFisher 553745, 1:1,000), Gαi3 (rabbit ...
-
bioRxiv - Immunology 2020Quote: ... or integrin αL (clone TS1/22, ThermoFisher) or mouse IgG1κ isotype control (clone 11711 ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed in PBS and stained with a mix of secondary antibodies anti-human IgG-Fc-AF647 (1:600) and anti-human IgA-Alpha-Chain-AF488 (1:200) (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... washed 3 x 5 min with PBS and incubated with Alexa Fluor-488 goat anti human secondary (Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the C-terminal foldon trimerization motif followed by an 8×His-tag was cloned into the pcDNA3.1(+) expression vector (Invitrogen). Furthermore ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... extended with a nucleic acid sequence encoding for 6 histidine residues (His-tag) and cloned into the mammalian expression vector pcDNA3.1(+) (Invitrogen). The soluble antigen was produced by transient gene expression in CHO cells as described previously [38] and purified from the cell culture medium by Ni-NTA resin (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... and C-terminal foldon trimerization motif followed by hexa-His tag) were used to transiently transfect Expi293F cells (Gibco). Four days after transfection ...
-
bioRxiv - Plant Biology 2022Quote: ... fused with an N-terminal 6×His-tag and cloned into expression vector pPIC9 (Thermo Fisher Scientific, California, USA). Correctness of the resulting constructs was confirmed by DNA sequencing prior to introduction into Pichia pastoris strain GS115 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was confirmed by western blot using a 6x His-Tag HRP conjugated Monoclonal Antibody (Thermo Fisher Scientific). Once verified ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Microbiology 2019Quote: Bacterially expressed ZIKV EDIII proteins (C-terminal 6 × His-tag) were conjugated to Ni-NTA Magnetic beads (Thermo Scientific) following manufacturers protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2023Quote: ... Protein detection was performed by incubation with a 6x-His Tag mouse monoclonal antibody (clone: HIS.H8; Thermo Fisher Scientific), followed by a secondary goat-anti-mouse HRP antibody (clone NA9310 N ...
-
bioRxiv - Immunology 2023Quote: ... Proteins containing a His-tag were purified by affinity chromatography using HisPur Ni-NTA resin (Thermo scientific, Cat#88222). Proteins were then eluted with 250 mM imidazole in 50 mM Tris-HCl and 300 mM NaCl ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then incubated for 1 h at room temperature with the following primary antibodies: mouse anti-His-Tag (dilution 1:1,000, clone HIS.H8, Invitrogen MA121315), mouse anti-Flag (dilution 1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were immunostained with anti-beta-3 Tubulin (Invitrogen, cat. no. 2G10-TB3, 1:500) in 2.5% NDS overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Human MSCs were cultured in alpha Modification of Eagle’s minimal essential medium (αMEM) (Thermo Fisher Scientific) supplemented with 15% FBS (Gemini Bio-Products) ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured in alpha minimum essential media (alpha-MEM, Invitrogen) supplemented with 15% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and transformed into NEB 5-alpha Competent Escherichia coli (High Efficiency, Thermo Fisher Scientific). Plasmids were isolated from individual colonies and sequenced with the universal primers pJET12F and pJET12R (Eurofins) ...