Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... containing a hexa-His tag was purified using HisPur Ni-NTA resin (Thermo Fisher Scientific). Expi cell supernatants were diluted with 1/3 volume of wash buffer (20 mM imidazole ...
-
bioRxiv - Biophysics 2023Quote: ... His-tag purification was performed in Pierce disposable polypropylene 5mL disposable columns (Thermo Fisher Scientific) with a wash solution containing TNi 100/300/20 (100 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Microbiology 2024Quote: Dynabeads™ His-Tag Isolation and Pulldown magnetic bead solution (Thermo Fisher Scientific, United States) kit was used for the detection of the binding partner of OipA ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using an anti-His tag monoclonal rabbit antibody (Thermo Fisher Scientific) and GST monoclonal mouse antibody (own antibody) ...
-
bioRxiv - Biochemistry 2023Quote: ... Pre-incubated mixture of scFv and respective whole venom was mixed with high-performance His-tag binding cobalt resin beads provided with Pierce™ His Protein Interaction Pull-Down Kit (Thermo Fisher Scientific, USA) and incubated at 20°C for 12 hours to allow attachment of the complex on resin via His-tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-β4 integrin (Thermo Fisher), Alexa Fluor 488 goat anti-mouse IgG2a (#A21131) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... A beta release of the Collibri 3’ mRNA Library Prep Kit (Invitrogen) was used to prepare libraries ...
-
bioRxiv - Microbiology 2020Quote: Luminex profiling was performed on whole blood that was allowed to clot for 20 minutes and then spun down using a custom mouse IFN kit (IFN alpha, IFN beta, IL-28, Invitrogen), mouse cytokine 23-plex (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Luminex kits that were used are as follows a custom mouse IFN kit (IFN alpha, IFN beta, IL-28, Invitrogen), mouse cytokine 23-plex (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies) using the oligos forward (BamHI ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... NC) or plasmid with HAX1 gene with tag on 3’end or 5’end of the gene (LipofectamineTM2000, ThermoFisher Scientific). Cells were detached and seeded on 100mm plates to grow single colonies (selection ...
-
bioRxiv - Neuroscience 2024Quote: ... Human cells were cultured in MEM-alpha medium (Fisher Scientific: Cat#12561-056) with 10% human platelet-derived lysate (Stem Cell Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amyloid Beta-40 ELISA was performed using the Human AB40 ELISA Kit (Invitrogen). Secretion values were normalized to protein content of wells as measured by RIPA harvest and BCA protein quantification.
-
bioRxiv - Microbiology 2019Quote: ... lipid membranes were incubated with a 6x-His tag polyclonal antibody HRP conjugate (MA1-21315, ThermoFisher) in blocking buffer for one hour at room temperature followed by three washes with wash buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... and labeled with 6x-His Tag Antibody coupled to Alexa 555 (Thermo Fisher, MA1-21315-A555). Coverslips were mounted on slides (Aqua-Poly/Mount ...
-
bioRxiv - Plant Biology 2021Quote: ... BgtCDA1 coding sequences with a 6XHIS tag were amplified and ligated into pPIC9K-HIS vector (Invitrogen), and then transformated into Pichia pastoris strain GS115 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... The his-tag was removed by cleavage overnight with AcTEV™ protease (Invitrogen, Carlsbad, California, USA) at 4ºC according to the provider’s protocol.
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were incubated 10 minutes at 4°C with Dynabeads™ His-Tag Isolation (Invitrogen, 10103D). After one wash with NLB buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Cell Biology 2022Quote: Genes encoding full-length human TAK1 and Mfn2 were fused with a 5’ hexahistidine-tag by PCR and then cloned into pFastBac1 vector (Life Technologies). Once constructed ...
-
bioRxiv - Immunology 2023Quote: ... followed by first strand cDNA synthesis using either a NSP4 gene-specific forward primer with a random nucleotide tag sequence (5’-cggtcatggtggcgaataaGCGGCCTTTAATGTGGAATG-3) or without any primer according to the SuperScriptTM III Reverse Transcriptase protocol (Invitrogen, 18080044). cDNA synthesis was then completed followed by a PCR using an eGFP gene-specific reverse primer (5’-CACCTTGATGCCGTTCTTCT-3’ ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the following primary/secondary antibodies: rabbit anti-6x-His Tag (ThermoFisher Scientific PA1-983B, 1:10,000), mouse monoclonal anti-GFP (Abcam ab1218 ...
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis-SNAP-Rab5B was then captured onto 20 μL Dynabeads His-Tag Magnetic Beads (Thermo Fisher Scientific) and washed three times in Ni-binding buffer in 2 mL Protein Lo Bind Tubes (Eppendorf) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ribosome nascent chain complexes (RNCs) were purified via the encoded His-Tag using magnetic Dynabeads (Invitrogen, #10104D). The translation reaction was applied to equilibrated beads (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... hPolεCD(insect) with a cleavable N-terminal His-Tev tag was cloned into pFastBac-1 plasmid (Invitrogen). hPolεCD and hPolεCD(exo- ...
-
bioRxiv - Biochemistry 2022Quote: ... The total protein level was detected by primary anti-His-tag antibody (1:10000, MA1-21315, Invitrogen) and secondary anti-mouse antibodies (1:5000 ...
-
bioRxiv - Biochemistry 2020Quote: ... The expression of the recombinant protein was measured by ELISA using anti‐His tag monoclonal antibody (Invitrogen) to capture and biotinylated anti‐ANG1 antibody for detection (R&D System) ...
-
bioRxiv - Immunology 2020Quote: ... were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat ...
-
bioRxiv - Cell Biology 2022Quote: ... 250 µl of the clarified lysate was mixed with 150 µl HIS-Tag isolation dynabeads (Invitrogen 10103D) and 750 µl US buffer for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... Eluted proteins were then incubated with Dynabeads His-Tag Isolation and Pulldown (Thermo Fisher Scientific, Waltham, Massachusetts) for 20 minutes and then washed 5 x 1 minute in His-tag Isolation Buffer (100 mM Na-phosphate ...
-
bioRxiv - Biochemistry 2023Quote: ... and co-expressed with MEI41-127 that was cloned as a His-tag fusion into pProEXHTb (Invitrogen). Supernatants were applied to Strep-Tactin XT resin (IBA ...
-
bioRxiv - Biochemistry 2023Quote: ... The His tag was digested during 14h at 4°C with histidine-tagged 3C proteases (Thermo Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... 6X-His Tag Monoclonal Antibody (HIS.H8) and Goat Anti-Mouse IgGH&L (HRP) were preferred (Thermo Scientific, Cat.#MA1-21315 ...
-
bioRxiv - Immunology 2024Quote: ... Plates were coated overnight at 4°C with 100 ng of 6x His tag monoclonal antibodies (Invitrogen) in PBS and washed the next day ...
-
bioRxiv - Immunology 2020Quote: ... integrin αE (Thermo Fisher Scientific, 2E7), Bax (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-integrin β8 (Invitrogen PA5-100843), anti-phospho-p65 (Abcam ab194726) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-integrin β5 (Invitrogen PA5-118499), anti-integrin β6 (Invitrogen PA5-47309) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-integrin β6 (Invitrogen PA5-47309), anti-integrin β8 (Invitrogen PA5-100843) ...
-
bioRxiv - Cancer Biology 2021Quote: ... FAM-labeled target primer and endogenous human ACTB control (beta actin) (Thermo Fisher Scientific) were mixed with master mix and template ...
-
bioRxiv - Microbiology 2020Quote: ... All human MARCH cDNAs were cloned into pCDNA3.1/myc-His A (Invitrogen) and were then subcloned into pBJ5 ...
-
bioRxiv - Microbiology 2023Quote: ... human MARCH4 and mouse MARCH2 (mMARCH2) into pcDNA3.1/myc-His A (Invitrogen) and pBJ5 vector have been previously described (10) ...
-
bioRxiv - Biophysics 2021Quote: ... 5% Fetal Calf Serum Heat Inactivated (FCS HI, Thermo Scientific) and 200μg/mL pennicilin/streptomycin (PS) ...
-
bioRxiv - Biophysics 2021Quote: ... 5% Fetal Calf Serum Heat Inactivated (FCS HI, Thermo Scientific) and 200μg/mL pennicilin/streptomycin (PS) ...