Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Genes encoding the full-length sequences of Human PP2A A subunit and PP2A C subunit with N-terminal His tag and non-cleavable HA tag were sub-cloned into the pFastBac-Dual vector (Invitrogen). Sequences of PP2A A and C subunits are shown in Table 1 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... An anti-6His antibody (6x-His Tag Polyclonal Antibody) and an anti-HA antibody (HA Tag Polyclonal Antibody) were purchased from Invitrogen. Western blot analysis was conducted as described previously 45.
-
bioRxiv - Microbiology 2022Quote: ... A recombinant SPATR (rSPATR) fused to a polyhistidine tag (His-tag) was produced in BL21-CodonPlus-RIL competent cells (Invitrogen) and protein purification was performed under denaturing conditions using Ni-NTA Agarose (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... TNF-alpha treatments were performed for 45 min using 25 ng/ml of human TNF-alpha (Thermo Fisher). Cells were permeabilized with 0.1% Triton X in phosphate-buffered saline (PBS ...
-
bioRxiv - Plant Biology 2019Quote: ... and anti-His tag (Alexa Fluor 555 conjugated, Thermo Fisher MA1-21315-A555) for 3 hours at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... dye free liposome was prepared with TexasRed conjugated anti-His tag Antibody (ThermoFisher) by mixing lipids with antibody containing buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His Tag Antibody (clone HIS.H8) (1:1000, # MA1-21315) was from ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and into pVL847 (His-MBP-tag overexpression vector) by Gateway cloning method (Invitrogen). ΔnahA mutant of Bacillus subtilis was constructed by CRISPR/Cas9 editing method (Ref) ...
-
bioRxiv - Immunology 2021Quote: ... plates were coated with 1 μg/mL 6x-His tag polyclonal antibody (Invitrogen) in 1x PBS for 6 hours at ambient temperature and blocked overnight with 0.5% NCS/5% Goat Serum/5% Milk/0.2% PBS-T ...
-
bioRxiv - Cell Biology 2021Quote: ... before being incubated with the primary antibody (6x-His Tag Monoclonal Antibody, Invitrogen) overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... the secondary antibody used was anti-6x-His tag monoclonal (Invitrogen, # MA1-21315) with 1:100 dilutions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6x-His Epitope Tag Monoclonal Antibody (#MA1-21315, Thermofisher Scientific; dilution 1:500) was used for His-tag staining of the TRPA1 channel in fixed cells for 1 h at RT ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μl of Dynabeads™ His-Tag Isolation and Pulldown beads (ThermoFisher 10104D) for each CFPS reaction were equilibrated twice in equal volumes of wash buffer before addition to the purified reactions to remove the Ulp-protease and incubated with spinning at 4 °C for at least 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... Successful binding was analyzed using anti-His Tag antibody (PCRD, Invitrogen #MA1-135) or anti-Myc Tag (DCRD ...
-
bioRxiv - Plant Biology 2024Quote: ... synthesized GUN1-FL protein was purified using His-Tag Dynabeads™ (Invitrogen; 10103D) and confirmed by Western blotting using His-tag antibody (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed and incubated for one hour with SULFO-TAG conjugated anti-human IgG for mAbs (MSD) or SULFO-TAG conjugated polyclonal anti-human IgG+A+M (Thermo Fisher) for serum samples ...
-
bioRxiv - Immunology 2020Quote: ... PR8-HA and SARS-CoV-2 S proteins with C-terminal Avi-tags and His-tags were expressed via transient transfection of Expi293 suspension cultures (Thermo Fisher) and purified by polyhistidine-tag affinity and size exclusion chromatography ...
-
bioRxiv - Immunology 2024Quote: ... Trichoplusia ni (Hi-5, Thermo Fisher Scientific) and Spodoptera fugiperda (Sf9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cas9 as well as the flanking 5’ and 3’ nuclear localizing sequences and 5’-V5 tag from the GeneArt CRISPR Nuclease Vector (Thermo Fisher Scientific). HEK293-Cas9 cells were maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Immunology 2021Quote: Human TNF alpha Uncoated ELISA Kit (ThermoFisher, catalog no. 88-7346) was used to determine secretion of TNF-α in culture supernatants of cells treated with SARS-CoV-2 S1 subunit ...
-
bioRxiv - Cell Biology 2024Quote: ... and human GRO alpha (CXCL1) Uncoated ELISA (88-52122-22, Invitrogen). Collagen type II synthesis ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Bioengineering 2020Quote: ... rabbit monoclonal anti-6x-His tag at 1:1,000 (Thermo Fisher Scientific, MA5-33032), and mouse monoclonal anti-β-actin at 1:10,000 (R&D Systems ...
-
bioRxiv - Microbiology 2022Quote: ... or membrane probed with mouse monoclonal 6x-His tag antibody (4A12E4) (Thermofisher, Waltham, MA) (Supplementary Figure 2).
-
bioRxiv - Microbiology 2019Quote: Qst was fused to a His-tag using the pEXP5-CT/TOPO vector (Invitrogen) following the TA-cloning protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: Pull-down assays were carried out using Dynabeads His-tag Isolation and Pulldown (Invitrogen). The 6His-tagged soluble pilin domains were used as bait ...
-
bioRxiv - Plant Biology 2022Quote: ... and purified by Dynabeads™ His-Tag Isolation and Pulldown (ThermoFisher, Catalog number 10103D). DA1 swapped protein ubiquitylation reactions used E1 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and probed with 6x-His Tag Monoclonal Antibody (HIS.H8) (Thermo Fisher Scientific #MA1-21315) diluted in 5% milk in PBS-T (1:500) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then used the Dynabeads His-Tag Isolation and Pull- down kit (ThermoFisher 10103D) to isolate his-tagged Fcy1 following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was then processed through a His-tag cobalt resin (ThermoFisher, Waltham, MA, USA) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Recombinant SARS-CoV-2 S-RBD fused with Fc/His tag (S-RBD-His) was produced in 293T cells and purified with Protein A Agarose (Thermo Fisher Scientific). Recombinant human ACE2-ECD fused with Flag/His tag was produced in 293T cells and purified with anti-DYKDDDDK G1 Affinity Resin according to the manufacturer’s instructions (GenScript).
-
bioRxiv - Immunology 2022Quote: ... Soluble forms of the SOSV antigens with were purified by using the proteins’ 6×-His tag or StrepII tags and Expi293F cells and Expifectamine 293 expression system (Thermo Fisher Scientific) as discussed below at day 5 to 7 post-transfection ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... a mouse anti-beta 3 tubulin antibody (Invitrogen, MA1-118,1:200) was used.
-
bioRxiv - Bioengineering 2019Quote: ... and hMSCs and MS-5 in MEM Alpha (Life Technologies). All medium were supplemented with 10 % heat-inactivated fetal bovine serum (FBS) ...
-
bioRxiv - Microbiology 2024Quote: ... C-His-OipA protein was purified by using Dynabeads™ His-Tag Isolation and Pulldown magnetic bead system (Thermo Fisher Scientific, United States). His-tagged OipA protein isolation procedure was carried out according to kit instructions ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Microbiology 2021Quote: ... Human alpha-1 PDX (alpha1-PDX) recombinant protein was purchased from ThermoFisher Scientific.
-
bioRxiv - Molecular Biology 2023Quote: The cDNAs encoding MpRBOHB and its variants with 3 × FLAG tag at their 5’-end were cloned into the pcDNA3.1(-) vector (Invitrogen) for the quantitative measurement of ROS in HEK293T cells.
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-6x-His epitope tag monoclonal antibody (Thermo Fisher Scientific, Cat. No. MA1-21315); LI-COR IRDye 800CW goat anti-rabbit IgG (LI-COR ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Im7-6 was purified from IVG reactions using magnetic His-tag Dynabeads (Thermo Fisher Scientific). The IVG reactions were diluted in 90 µl of Buffer 1 (50 mM NaH2PO4 and 300 mM NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... The his-tag was cleaved using AcTEV protease according to manufacturer’s instructions (Invitrogen, Carlsbad, CA), and the his-tagged protease and noncleaved uSpike protein were removed by binding to Ni-NTA resin ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were incubated with Alexa Fluor 488–conjugated 6x-His Tag monoclonal antibody (ThermoFisher) for 1 hour at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA coated magnetic beads (Dynabeads™ His-Tag Isolation and Pulldown from Invitrogen, USA) were added to the solution and incubated for 10 additional min in order to bind the his-tagged TDF and PKnG proteins ...
-
bioRxiv - Systems Biology 2019Quote: ... The His tag was cleaved by overnight incubation at 4 °C with SUMO protease (Invitrogen), after which the sample was loaded again onto a HisTrap FF column to recover the cleaved products ...
-
bioRxiv - Developmental Biology 2020Quote: ... and verified by Western blot with primary antibodies against 6x His tag (Invitrogen, MA1-21315), and DLX1 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... the constructs were all based on a pcDNA3.1 vector containing a V5/His-tag (Invitrogen). Untagged constructs for comparison were prepared by introducing a stop codon into the pcDNA3.1/V5-His constructs using the same site-directed mutagenesis kit as above ...
-
bioRxiv - Microbiology 2022Quote: ... Then 1 μl of Dynabeads™ His-Tag Isolation and Pulldown magnetic beads (ThermoFisher Scientific) were added into each well ...
-
bioRxiv - Microbiology 2022Quote: ... 0.02% Tween-20) and added to 20 μl Dynabead His-Tag beads (ThermoFisher Scientific; 10103D). After incubation on a roller at 4°C for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: ... each with an N-terminal (His)6 tag from plasmids generated by GeneArt (ThermoFisher Scientific). For each purification ...