Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5 ug/ml human Gibco transferrin (Fisher Scientific), 1 ug/ml human insulin (Sigma) ...
-
bioRxiv - Biophysics 2019Quote: ... mouse anti-Integrin (IGTB1; clone 2B1, Fisher Scientific cat # MA10690), 1:100 ...
-
bioRxiv - Biophysics 2022Quote: ... Integrin β1 (ITGB1) siRNA (#AM16708) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were plated at a density of 5×104 mononuclear cells per cm2 in alpha MEM (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2019Quote: ... The purity of affinity purified histidine tagged CsgF was investigated using SDS PAGE and the presence of the histidine tag was confirmed by western blot using an Anti-His (C-Term)-HRP antibody (Life Technologies, Carlsbad, CA).
-
bioRxiv - Microbiology 2020Quote: ... and blots were incubated for 1 h with a 1:1,000 dilution of anti 6X-His Tag rabbit antibodies (Thermo Fisher Scientific, Massachusetts, USA) followed by a 1 h incubation with a 1:3,000 dilution of goat anti-rabbit IgG coupled to HRP secondary antibodies (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... anti-His tag antibody molecules were tagged with the dye Alexa Fluor® 647 NHS Ester (Succinimidyl Ester, ThermoFisher SCIENTIFIC, Catalog number: A20006) using the same procedure as followed in our previous paper.(11 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dm III-2 and Dm III-2 + cys production was confirmed via western blot using 6x His-tag Ab (Invitrogen, Carlsbad, CA, USA). Positive clones were expanded ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was probed with primary antibodies including anti-tau mouse ET3 (1:1000 dilution) and 6X - His Tag rabbit monoclonal antibody (Invitrogen, 1:3500 dilution). The secondary antibodies used were ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His-tagged constructs of human and murine SNED1 cloned into pCDNA5/FRT (Thermo Fisher, Waltham, MA) between the FseI and AscI sites were used to transiently transfect 293T cells to validate the anti-SNED1 antibody generated in this study (Supplementary Figure S1) ...
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Cell Biology 2019Quote: ... or anti-alpha Tubulin (Invitrogen) antibody for 4 hours at room temperature or overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-alpha-tubulin (ThermoFisher, #62204), anti-LAMP2 (BioLegend ...
-
bioRxiv - Developmental Biology 2023Quote: ... alpha-MEM (Thermo Fisher Scientific) was supplemented with 2.5 % FBS ...
-
bioRxiv - Immunology 2023Quote: ... Expression constructs for M35-V5/His and M27-V5/His (both in pcDNA3.1-V5/His, Invitrogen) have been described previously (Munks et al ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1x beta-mercaptoethanol (Life Technologies), 200 ng/mL Recombinant mouse Noggin (R&D systems) ...
-
bioRxiv - Neuroscience 2021Quote: ... Beta Actin (Thermofisher; Cat # Mm02619580), Smoc1 (Thermofisher ...
-
bioRxiv - Immunology 2022Quote: ... 50 mM beta-mercaptoenthanol (ThermoFisher) was also added ...
-
bioRxiv - Genomics 2019Quote: ... beta-Actin (Life Technologies AM4302).
-
bioRxiv - Immunology 2021Quote: ... 50 µM beta-mercaptoethanol (Gibco). FBS was heat-inactivated for 30 min at 56°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1x Beta-mercaptoethanol (Life Technologies), 100 U/mL Penicillin/100 µg/mL Streptomycin (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... 55 μM beta-mercaptoethanol (Invitrogen), 1x GlutaMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... 1x Beta-mercaptoethanol (Life Technologies), 100 U/mL Penicillin/100 μg/mL Streptomycin (Life Technologies) ...
-
bioRxiv - Genetics 2020Quote: ... 1x beta-mercaptoethanol (Life Technologies), 1mM PD03259010 ...
-
bioRxiv - Genetics 2020Quote: ... 1x beta-mercaptoethanol (Life Technologies) and 1000 units/ml leukemia inhibitory factor (ESGRO ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 µM beta-mercaptoethanol (Gibco), 1 % nonessential amino acids (NEAA ...
-
bioRxiv - Genetics 2019Quote: ... 0.1mM Beta-Mercaptoethanol (Gibco 31350010), 103 units/mL LIF (Millipore ...
-
bioRxiv - Genomics 2021Quote: ... 0.1mM beta-mercaptoethanol (Gibco #21985023), and LIF ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.2% Beta-Mercaptoethanol (Life technologies), 300ng/mL of mouse SCF (SCT or Bio-Techne ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1x Beta-mercaptoethanol (Life Technologies), 100 U/mL Penicillin/100 μg/mL Streptomycin (Life Technologies) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10uM beta-mercaptoethanol (Fisher Scientific), and 104 U/mL ESGRO LIF (Sigma Millipore) ...
-
bioRxiv - Genetics 2022Quote: ... 0.1% Beta-mercaptoethanol (Thermofisher 21985023), 100ug/mL Primocin (Invivogen ant-pm) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 µM beta-mercaptoethanol (Invitrogen), brain-derived neurotrophic factor (20 ng/mL ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 µM beta-mercaptoethanol (Invitrogen) and 25 ng/ml of Activin A (Bio-Techne) ...
-
bioRxiv - Immunology 2022Quote: ... TEM Beta (Thermo Fisher Scientific) at Stanford-SLAC Cryo-EM CenterS2C2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1X beta-mercaptoethanol (Gibco 21985023), 1x non-essential amino acids (Gibco 11140050) ...
-
bioRxiv - Cancer Biology 2023Quote: ... beta Actin(ThermoFisher, MA5-16410), HRP Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Neuroscience 2023Quote: ... Beta Actin (Thermofisher; Cat # Mm02619580), Smoc1 (Thermofisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... beta-mercaptoethanol (Gibco, 31350-010), penicillin/streptomycin (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 µM beta-mercaptoethanol (Gibco), 0.1 mM Non-Essential Amino Acids (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... and 1X beta-mercaptoethanol (ThermoFisher). Media was additionally supplemented with 10 ng/mL murine IL-2 (BioLegend ...