Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... STAT5 alpha/beta (Phospho) [pY694/pY699] Human InstantOne™ ELISA Kit (ThermoFisher, MA, USA), anti-mouse CD3 antibody (Proteintech ...
-
bioRxiv - Systems Biology 2021Quote: ... Tn5 underwent a His-tag (Dynabeads His-Tag Isolation & Pulldown, Invitrogen, 10103D) clean-up according to the manufacturer’s protocol to remove unbound oligos before using.
-
bioRxiv - Cancer Biology 2023Quote: ... and His-tag (Invitrogen) were used ...
-
bioRxiv - Genomics 2021Quote: ... His-Tag purification was performed using Dynabeads His-Tag Isolation and Pulldown (Invitrogen, 10103D). Beads were allowed to bind to antibody-pA-Tn5 complex for 2 hours at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Microbiology 2020Quote: Dynabeads His-Tag Isolation & Pulldown (Invitrogen) were washed in PBS-TH (PBS ...
-
bioRxiv - Immunology 2021Quote: ... magnetic beads (Dynabeads His-Tag, Invitrogen) were coated with histidine tagged S protein according to the manufacturers’ instructions ...
-
bioRxiv - Immunology 2021Quote: 6x His tag monoclonal antibody (Invitrogen) was coated at 2 μg/mL in PBS onto half-area 96-well high binding plates (Corning ...
-
bioRxiv - Immunology 2021Quote: 6x His tag monoclonal antibody (Invitrogen) or streptavidin (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti‐His tag monoclonal antibody (Invitrogen) was used in western blot analysis.
-
bioRxiv - Immunology 2021Quote: ... were cloned into pCEP4 mammalian expression vector containing N-terminal human Ig kappa leader sequence and C-terminal Avi-tag and His-tag (Invitrogen, USA). Expi293-Freestyle cells cultured at 37°C and 8% CO2 in growth medium containing Expi293 Expression Medium at 3×106/mL in 50 mL media were transfected overnight at 37 °C with 50μg of plasmid in 160μL of ExpiFectamine plus 6mL of OptiMEM-I (all from Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... and anti-49 (0.5 μg/ml; Invitrogen eBioscience™ CD49d (Integrin alpha 4) Monoclonal Antibody ...
-
bioRxiv - Microbiology 2019Quote: ... we used Dynabeads™ His-Tag (Invitrogen) for Ni-affinity purification ...
-
bioRxiv - Bioengineering 2022Quote: 6x-His tag antibodies (Invitrogen, MA1-21315) were coated at 2 µg/mL in PBS onto 96-well half- area high binding plates (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... 6x-His Tag antibody is from ThermoFisher Scientific (MA1-21315-D550) ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-His Tag (Invitrogen MA1-21315). Secondary antibody used are ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-His tag (ThermoFisher Scientific, MA1-21315), and anti-tubulin (DHSB ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled HIV-1JR-FL Env(-) carrying the (His)6 epitope tag was incubated with biotin-conjugated anti-(His)6 tag antibody (HIS.H8, Invitrogen) at 4° for two hours.
-
bioRxiv - Genetics 2020Quote: ... and beta-3 Tubulin (ThermoFisher). Membranes were washed three times with TBST and then incubated with secondary antibodies for 1 hour at RT ...
-
Lactic Acid Containing Polymers Produced in Engineered Sinorhizobium meliloti and Pseudomonas putidabioRxiv - Microbiology 2019Quote: ... the gel was used for His-tag staining following the InVision(tm) His-tag In-Gel Stain protocol provided by Invitrogen.
-
bioRxiv - Microbiology 2020Quote: ... Tsp-his was detected with the Anti-6X His tag antibody (ThermoFisher Scientific), which is already conjugated with HRP and does not require a secondary antibody for detection ...
-
bioRxiv - Developmental Biology 2023Quote: ... For antibodies we used a His antibody (6x-His Tag Monoclonal Antibody, ThermoFisher), a MBP antibody (Anti-MBP Monoclonal Antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... His-tags were removed with AcTEV protease (Invitrogen) overnight and proteins further purified with a HiTrap SP HP cation exchange column (GE Healthcare).
-
bioRxiv - Immunology 2024Quote: Dynabeads His-Tag Isolation and Pulldown beads (ThermoFisher) were washed once with Tris-buffered saline (TBS ...
-
bioRxiv - Microbiology 2024Quote: ... anti-6*his tag (Thermo Fisher Scientific,11533923), anti-myc tag (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... with the addition of Super Bright 600 anti-CD49f (integrin alpha 6) antibody (Thermo Scientific, 63-0495-42 ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Biochemistry 2020Quote: ... Mouse anti-Penta-His-tag (#P-21315, ThermoFisher Scientific), 1:2000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-washed 25 µl His-Tag Dynabeads (ThermoFisher Scientific) were added ...
-
bioRxiv - Immunology 2020Quote: ... Primary antibodies against the His-tag (1:2000, Invitrogen) were followed by secondary HRP conjugated antibody (1:2000 ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against the His-tag (1:2000, Invitrogen) were followed by secondary HRP conjugated antibodies (1:2000 ...
-
bioRxiv - Immunology 2021Quote: 100 µL of Invitrogen His-Tag Dynabeads (ThermoFisher 10104D) were used for prefusion S2 depletion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 mL 6x His-Tag Monoclonal antibody (MA121315; Invitrogen) diluted 1:1500 in blocking solution supplemented with 0.1% NaN3 was added to the membrane and incubated at 4°C on an orbital shaker at 55 rpm for 14-16 h ...
-
bioRxiv - Biochemistry 2023Quote: ... His-Tag Dynabeads (Invitrogen 10103D, 10 µL per sample) was washed three times with B buffer before protein immobilization ...
-
bioRxiv - Biophysics 2023Quote: His-Tag Dynabeads (Invitrogen 10103D, 10 μL per sample) were manually washed three times with B buffer and resuspended in B buffer (100 μL per sample) ...
-
bioRxiv - Plant Biology 2023Quote: ... Dynabeads His-Tag Isolation and Pulldown (Thermo Fisher Scientific) were washed twice in Strep-to-His Buffer before adding the eluted proteins and incubating while rotating for 20 min ...
-
bioRxiv - Immunology 2024Quote: ... 1 mg of magnetic beads (Dynabeads His-Tag, Invitrogen) were coupled with 200 µg of histidine-tagged SARS-CoV-2 S protein ...
-
bioRxiv - Microbiology 2020Quote: rCEACAM-His was attached to nickel dynabeads (DB; Dynabead His-tag pull-down & isolation, Invitrogen) following standard protocols ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The washed membrane was then incubated overnight at 5°C with a 6x-His-Tag monoclonal antibody (Invitrogen) diluted 2500-fold in PBS-Tween ...
-
bioRxiv - Immunology 2021Quote: ... The expression vectors encoding mHVEM (Q39-Q206) fused with human IgG1 and a subsequent hexa-His tag sequences were transfected into Expi293 (Gibco) cells using ExpiFectamine 293 transfection kit (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... The DNA sequences encoding a protein biologic composed of mHVEM residues (Q39- Q206) followed by human IgG1 and a subsequent hexa-His tag sequences were cloned into pcDNA 3.3 vector (Life technologies) using In-fusion HD cloning enzyme premix (Clontech) ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His tag Antibody (MA1-125 21315) was from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... An anti-His-tag antibody coupled to HRP (Thermo Scientific) was used for enzymatic detection ...
-
bioRxiv - Immunology 2020Quote: ... 1 mg of magnetic bead (Dynabeads™ His-Tag, Invitrogen) were coated with 70 μg of histidine tagged RBD ...
-
bioRxiv - Plant Biology 2022Quote: ... secondary anti-6x-His tag monoclonal antibody (Invitrogen, # MA1-21315) at 1:175 dilutions ...
-
bioRxiv - Neuroscience 2023Quote: ... 6x-His Tag Monoclonal Antibody (HIS.H8) (MA1-21315, Thermo Scientific) and HRP-conjugated goat anti-mouse secondary antibody (Abcam ab6789-1 MG ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated with a 6x-His-Tag monoclonal antibody (Invitrogen) diluted 2500-fold in PBS-Tween overnight ...
-
bioRxiv - Biophysics 2024Quote: 6x-His epitope tag antibody (His.H8) was purchased from Invitrogen. Monoclonal Flag M2 antibody (F1804-50UG) ...