Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... using 3 μL Lipofectamine 2000 (Invitrogen). Opti-MEM media was exchanged for DMEM supplemented with 10% FBS but lacking antibiotics for 4-5 hours following transfection ...
-
bioRxiv - Plant Biology 2024Quote: ... and Qubit 3 (Invitrogen, United States). RNA integrity was then assessed on an agarose gel.
-
bioRxiv - Cell Biology 2024Quote: ... particle size 3 µm (Fisher Scientific) at a flow rate of 5 μl/min and then separated using a 125-min gradient from 5 to 35% buffer B (0.5% formic acid in 80% acetonitrile ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2μl of annealing mix (5% ERCC RNA spike-In Mix (pre-diluted at 1:25,000; Invitrogen), 5% Oligo-dT (5⍰–AAGCAGTGGTATCAACGCAGAGTACT30VN-3⍰ ...
-
bioRxiv - Microbiology 2020Quote: ... and in the presence of 5 μg ml-1 of erythromycin (Acros Organics, New Jersey, USA). The strain was preserved as a glycerol stock at −80° C.
-
bioRxiv - Microbiology 2019Quote: ... unprimed cells were transfected with LPS (5 μg/ml) using Lipofectamine 2000 (1% v/w; Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... Sequence PCR (total volume 5 µl) was carried out with 1 µl Big dye (Applied Biosystems), 1 µl Forward primer ...
-
bioRxiv - Immunology 2019Quote: ... Excised lungs were places in DMEM substituted with 5% FBS and 1% Penicillin/Streptomycin (all Gibco). Lungs were immediately sliced into 300μm thick sections on a vibratome and stained with directly conjugated Ab in complete medium (phenol-red free DMEM substituted with 10% FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated for 5 nights in 1 μg/mL streptavidin conjugated to Alexa Fluor-568 (Invitrogen) in PBS that was supplemented with 1% Triton x-100 and 0.5% dimethylsulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reaction was quenched 1:5 with wash buffer DMEM/F12 (Thermo Fisher Scientific, 11320-082) containing 0.1% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 647 donkey anti-mouse IgG (H+L) (A31571) (Molecular Probes, 1:500 (Figure 5) or 1:200 (other figures)).
-
bioRxiv - Bioengineering 2021Quote: ... Cultures were diluted 1:5 in 150 μl with Phosphate Buffer Saline (PBS) from Life Technologies immediately before analysis by flow cytometry on the BD LSR Fortessa X-20 (BD Biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg/ml BSA] supplemented with 1 U per 20 µL SUPERase-In RNase Inhibitor (ThermoFisher) and incubated at 37 °C for 1 hour.
-
bioRxiv - Microbiology 2021Quote: ... and incubated in with 1.5 μM of the JC-1 dye (5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolylcarbocyanine Iodide, T3168, Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM each dNTPs and a 1:6,000,000 dilution of ERCC RNA Spike-In Mix (Invitrogen) was added followed by incubation at 72 °C for 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Biochemistry 2022Quote: ... 750 µl of live cell medium containing 1 µl of 5 mg/ml Hoechst 33342 (Invitrogen), resulting in a 5 µM concentration of Hoechst 33342 and 5 µg/ml CellMask™ Deep Red and were incubated for another 8 min at 37 °C and 5 % CO2 (total incubation of 30 min) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were diluted to 5 x 105 cells/mL in RPMI + 10% FCS (Gibco) and treated with 100 nM phorbol 12-myrystate-13-acetate (PMA ...
-
bioRxiv - Biochemistry 2022Quote: ... frataxin (100μL of 1-5 μg/mL) was directly bound to the MaxiSorp microtiter plates (NUNC), and BSA (bovine serum album ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were stained with 5 μg/ml of 5,5′,6,6′-tetraethylbenzimidazolyl-carbocyanine iodide (JC-1; Invitrogen) for 30 min at 37 °C following a published procedure(17) ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were filtered and incubated for 5 minutes in 1:1000 Hoechst (Invitrogen H3569, Waltham MA). 10,000 Hoechst + nuclei from the suspension were then sorted directly into 10x Genomics RT buffer (Pleasanton ...
-
bioRxiv - Microbiology 2022Quote: ... with 1:5 diluted cDNA in technical duplicate in a StepOne Plus qPCR instrument (Applied Biosystems). A standard curve made from plasmid encoding the gene of interest or a purified PCR product was used to enumerate gene copies in each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 5% fetal bovine serum (FBS) and 1% antibiotics (penicillin G/Streptomycin, Gibco, Waltham, MA) in a humidified atmosphere containing 5% CO2 at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 5% fetal bovine serum (FBS) and 1% antibiotics (penicillin G/Streptomycin, Gibco, Waltham, MA) in a humidified atmosphere containing 5% CO2 at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... incubated with secondary fluorescent antibodies (used at 1-5 μg/ml; Jackson Laboratories or Thermo Fisher) for 2 h at RT ...
-
bioRxiv - Systems Biology 2021Quote: ... which contained 5% fetal bovine serum (FBS; SH30070.03, HyClone) and 1% penicillin-streptomycin (15140-122, Gibco), and quickly transported to the laboratory on ice ...
-
bioRxiv - Biophysics 2021Quote: ... centrifuged (5,000 x g for 5 min) and incubated in 10μM YO-PRO-1 iodide (Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 minute at 60°C)] on a QuantStudio 5 or QuantStudio 7 qPCR machine (Applied Biosystems). For qPCR assessments ...
-
bioRxiv - Cell Biology 2020Quote: ... this base media was further supplemented with 1-5% knockout serum replacement (KSR; ThermoFisher Scientific 10828028) as described60,33 ...
-
bioRxiv - Genomics 2020Quote: ... and 30 µL from each sample was diluted 1:5 with serum-free MEM (ThermoFisher Scientific), and added to individual wells of a 12 well plate with confluent BF-2 monolayers ...
-
bioRxiv - Neuroscience 2020Quote: ... or primary antibody against Cld-5 (mouse monoclonal, C43C2, 35-2500, Thermo Fisher scientific, 1:200). AFL was labeled at the Fc portion of human IgG immunoglobulin (goat polyclonal anti-human IgG Fc antibody ...
-
bioRxiv - Microbiology 2022Quote: The samples were counterstained using 5 ng ml-1 DAPI dissolved in SlowFade Gold (Invitrogen, USA) and covered with a #1.5 high precision coverslip (Marienfeld ...
-
bioRxiv - Immunology 2022Quote: ... 2-5×106 cells were incubated in 15 μl Indo-1 solution in 1ml IMDM (Gibco) + 1%FBS (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... VOs we’re fixed for 1 hour in 4% paraformaldehyde solution (Thermo Fisher Scientific, 7732-18-5) in PBS and for 2 hours in 2.5% glutaraldehyde in PHEM buffer (TAAB ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were loaded with Fura-2 AM at 1 μg/mL (108964-32-5, Life Technologies) in HBSS or Fluo-4 AM at 10 μM in (ThermoFisher ...
-
bioRxiv - Genetics 2024Quote: ... we mixed 5 µL of PCR product with 1 µL of 6X loading dye (ThermoFisher Scientific) and ran samples on 2% agarose gels stained with RedSafe (FroggaBio ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary AlexaFluor-conjugated antibodies (Life Technologies; 1:500 in 5% FBS, 0.1% Triton-X in PBS) with Hoechst 33342 dye were incubated for 1 h at room temperature in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (1 μg) was ligated to the 5’-phosphorylated RNA adaptor using T4 RNA Ligase (Ambion). Following ligation ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 1 h incubation in the blocking buffer (5% Fetal Bovine Serum (FBS, Gibco, USA) and 1% Bovine Serum Albumin (BSA ...
-
bioRxiv - Biochemistry 2023Quote: ... an aliquot (30 μL) of resuspended beads and anti-Tau-5 antibody (Thermo Fisher, 1:250) were added to prepared lysates and incubated at 4 °C overnight with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... and stained with 5 μg mL−1 Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells were then incubated with 1 mg/ml of pHrodo-labeled S.aureus bioparticles (ThermoFisher) for 1 hour at 4 °C to determine non-specific binding on the cell surface (binding control) ...
-
bioRxiv - Cell Biology 2023Quote: ... Magnesium 1 M (cat: AM9530G) and Sodium chloride 5 M (cat: AM9759) were obtained from Ambion. Ultrapure water (cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified 5′ ligated RNAs were mixed with 1 μl random hexamers (50 μM, N8080127, ThermoFisher Scientific), 1 μl dNTP mix (10 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... and were maintained in DMEM supplemented with 5% FBS and 1% GlutaMax (Life Technologies, Carlsbad, CA) in a 37°C CO2 incubator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoblots were then incubated in secondary goat anti-rabbit (1:1000 TBST/5% milk; Invitrogen, 32460) 1h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were first incubated for blocking with 5% BSA (bovine serum albumin, BP1600-1 Fisher Scientific) in PBT (0.3% Triton X-100 (ACROS ...
-
bioRxiv - Neuroscience 2023Quote: Cells were incubated in presence of either 1 μM or 5 μM MitoSoxTM (Invitrogen; Cat. #M36008) for 30 minutes in medium containing Hoechst (1/2,000 dilution) ...