Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... quantified by Qubit 3 fluorometer (Invitrogen) and quality assessed by bioanalyzer (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... QuantStudio 3 RealTime qPCR (Applied Biosystems). Data were analyzed by using the second-derivative maximum method ...
-
bioRxiv - Immunology 2023Quote: ... LAG-3-APC-eFluor 780 (Invitrogen), SlamF6-APC (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... LAG-3-APC-eFluor 780 (Invitrogen), ICOS-Super Bright 436 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... TO-PRO-3 Iodide (TOPRO) (ThermoFisher) was used as a nuclear counter-stain.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... (QuantStudio 3, Applied Biosystems, Thermo Fisher) in a 96-well plate (USA Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... (QuantStudio 3, Applied Biosystems, Thermo Fisher) in a 96-well plate (USA Scientific ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... Antibodies: Galectin 3 (Invitrogen MA1-940), Galectin 9 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... on a Qubit 3 fluorometer (Invitrogen). gDNA was fragmented in TE buffer using the Covaris ultra sonicator (ME220 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrations of viral particles were verified via qPCR using a lentiviral titration kit from Applied Biological Materials on QuantStudio 3 from Thermo Fisher.
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... mouse anti-Galectin 3 (Thermo Fisher Scientific Cat# MA1-940 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 3 µM propidium iodide (Invitrogen). Then ...
-
bioRxiv - Bioengineering 2024Quote: ... 3-10 were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Physiology 2024Quote: ... and 3 mg/ml dispase (Gibco 17105-041 ...
-
bioRxiv - Neuroscience 2024Quote: ... C - 3 days (Neurobasal media (Gibco) + N2 supplement (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... Step 3 (StemPro-34 SFM (Gibco) + 2 mM GlutaMAX + 50 ng/ml SCF (PeProtech ...
-
bioRxiv - Neuroscience 2024Quote: ... B -3 days (Neurobasal media (Gibco) + N2 supplement (Gibco ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 μM CHIR99021 (SML1046-5MG, Invitrogen) and 1 μM PD0325901 (PZ0162-5MG ...
-
bioRxiv - Neuroscience 2023Quote: ... washed x 3 with dPBS (ThermoFisher) and coated ON with 50 μg/ml laminin (Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... and DiOC18(3) (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2023Quote: ... 50x2.1 mm 3 µm (Thermo Scientific) and a Hypercarb Guard Porous Graphitic Carbon HPLC Column ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3% NHS (Gibco, 16050-122). Primary antibody incubation was performed overnight with rabbit anti-VGlut1 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2024Quote: ... on a QuantStudio 3 (Applied Biosystems), and all primers are listed in Table 1 ...
-
bioRxiv - Bioengineering 2024Quote: ... 3% hESC quality FBS (10439001, ThermoFisher), 100 µM 2-mercaptoethanol (21-985-023 ...
-
bioRxiv - Bioengineering 2024Quote: qPCR equipment (Quantstudio 3, Applied Biosystems)
-
bioRxiv - Neuroscience 2023Quote: ... GST-14-3-3s constructs (Invitrogen) were transformed into Escherichia coli strain BL21 (DE3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2μl of annealing mix (5% ERCC RNA spike-In Mix (pre-diluted at 1:25,000; Invitrogen), 5% Oligo-dT (5⍰–AAGCAGTGGTATCAACGCAGAGTACT30VN-3⍰ ...
-
bioRxiv - Microbiology 2020Quote: ... and in the presence of 5 μg ml-1 of erythromycin (Acros Organics, New Jersey, USA). The strain was preserved as a glycerol stock at −80° C.
-
bioRxiv - Microbiology 2019Quote: ... unprimed cells were transfected with LPS (5 μg/ml) using Lipofectamine 2000 (1% v/w; Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... Sequence PCR (total volume 5 µl) was carried out with 1 µl Big dye (Applied Biosystems), 1 µl Forward primer ...
-
bioRxiv - Immunology 2019Quote: ... Excised lungs were places in DMEM substituted with 5% FBS and 1% Penicillin/Streptomycin (all Gibco). Lungs were immediately sliced into 300μm thick sections on a vibratome and stained with directly conjugated Ab in complete medium (phenol-red free DMEM substituted with 10% FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated for 5 nights in 1 μg/mL streptavidin conjugated to Alexa Fluor-568 (Invitrogen) in PBS that was supplemented with 1% Triton x-100 and 0.5% dimethylsulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reaction was quenched 1:5 with wash buffer DMEM/F12 (Thermo Fisher Scientific, 11320-082) containing 0.1% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 647 donkey anti-mouse IgG (H+L) (A31571) (Molecular Probes, 1:500 (Figure 5) or 1:200 (other figures)).
-
bioRxiv - Bioengineering 2021Quote: ... Cultures were diluted 1:5 in 150 μl with Phosphate Buffer Saline (PBS) from Life Technologies immediately before analysis by flow cytometry on the BD LSR Fortessa X-20 (BD Biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg/ml BSA] supplemented with 1 U per 20 µL SUPERase-In RNase Inhibitor (ThermoFisher) and incubated at 37 °C for 1 hour.
-
bioRxiv - Microbiology 2021Quote: ... and incubated in with 1.5 μM of the JC-1 dye (5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolylcarbocyanine Iodide, T3168, Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM each dNTPs and a 1:6,000,000 dilution of ERCC RNA Spike-In Mix (Invitrogen) was added followed by incubation at 72 °C for 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Biochemistry 2022Quote: ... 750 µl of live cell medium containing 1 µl of 5 mg/ml Hoechst 33342 (Invitrogen), resulting in a 5 µM concentration of Hoechst 33342 and 5 µg/ml CellMask™ Deep Red and were incubated for another 8 min at 37 °C and 5 % CO2 (total incubation of 30 min) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were diluted to 5 x 105 cells/mL in RPMI + 10% FCS (Gibco) and treated with 100 nM phorbol 12-myrystate-13-acetate (PMA ...
-
bioRxiv - Biochemistry 2022Quote: ... frataxin (100μL of 1-5 μg/mL) was directly bound to the MaxiSorp microtiter plates (NUNC), and BSA (bovine serum album ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were stained with 5 μg/ml of 5,5′,6,6′-tetraethylbenzimidazolyl-carbocyanine iodide (JC-1; Invitrogen) for 30 min at 37 °C following a published procedure(17) ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were filtered and incubated for 5 minutes in 1:1000 Hoechst (Invitrogen H3569, Waltham MA). 10,000 Hoechst + nuclei from the suspension were then sorted directly into 10x Genomics RT buffer (Pleasanton ...
-
bioRxiv - Microbiology 2022Quote: ... with 1:5 diluted cDNA in technical duplicate in a StepOne Plus qPCR instrument (Applied Biosystems). A standard curve made from plasmid encoding the gene of interest or a purified PCR product was used to enumerate gene copies in each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 5% fetal bovine serum (FBS) and 1% antibiotics (penicillin G/Streptomycin, Gibco, Waltham, MA) in a humidified atmosphere containing 5% CO2 at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 5% fetal bovine serum (FBS) and 1% antibiotics (penicillin G/Streptomycin, Gibco, Waltham, MA) in a humidified atmosphere containing 5% CO2 at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... incubated with secondary fluorescent antibodies (used at 1-5 μg/ml; Jackson Laboratories or Thermo Fisher) for 2 h at RT ...