Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 7360 citations for HEPACAM Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA from HEK 293T cells (N = 2 biological replicates) or whole mouse brain (N = 6 biological replicates) was extracted using TRIzol (ThermoFisher) and treated with RNase-free DNase I (Promega) ...
-
bioRxiv - Genomics 2020Quote: Live cell images of NIH3T3 cells (Fig. 1B) and HEK 293T cells (Fig. S1B) were taken and digitally recorded using FLoid Cell Imaging Station (ThermoFisher). In the experiments with ActD treatments (Fig ...
-
bioRxiv - Bioengineering 2020Quote: ... 2013) and co-transfected with plasmids containing Cas9 effectors into A375 or HEK 293FT cells using Lipofectamine 2000 (ThermoFisher 11668019). The transfected cells were selected with 2 μg ml-1 puromycin for 72 h ...
-
bioRxiv - Genomics 2020Quote: HEK 293T and HeLa cells were obtained from ATCC and maintained in DMEM supplemented with 10% FBS (ThermoFisher Scientific, 10082147) and antibiotics at 37°C in 5% CO2.
-
bioRxiv - Microbiology 2020Quote: ... Human embryonic kidney 293T cells (HEK 293T) (Pear et al., 1993) were maintained in Dulbecco’s modified Eagle medium (DMEM; ThermoFisher Scientific) supplemented with FBS ...
-
bioRxiv - Immunology 2019Quote: ... Fabs and IgGs were produced by transient transfection in suspension 293F or adherent HEK 293T cells using Lipofecatamine 2000 (Invitrogen) or polyethylenamine (PEI) ...
-
bioRxiv - Immunology 2021Quote: Human embryonic kidney (HEK) 293T cells were acquired from ATCC and cultured in DMEM media supplemented with 10% fetal bovine serum (FBS; Gibco) and 100 U/mL of penicillin and 100 μg/mL streptomycin (Gibco) ...
-
bioRxiv - Zoology 2022Quote: HEK 293T cells were a gift from Kristin Dittenhaffer-Reed (Hope College, USA) and grown in DMEM (ThermoFisher Sci. #11965092) with 10% FBS (ThermoFisher Sci ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant containing lentivirus was generated by seeding 3.8 x 105 cells x ml-1 HEK 293FT cells (Invitrogen R700-07) in 10 cm tissue culture plates (10 ml per plate ...
-
bioRxiv - Neuroscience 2023Quote: ... Media in 10 cm TC dishes with HEK 293T cells (at around 70% confluence) were replaced with Opti-MEM (Invitrogen). Then the SSF-MOR plasmid ...
-
bioRxiv - Immunology 2023Quote: ... the signal was evaluated after 48 hours by detection of GFP expression in the HEK-293T-hACE2 cells using Attune NxT Acoustic Focusing Cytometer (ThermoFisher) or BD Symphony Flow Cytometry.
-
bioRxiv - Immunology 2023Quote: Human embryonic kidney (HEK) epithelial-like cell line HEK293T was maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (11965-118; GIBCO™, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: The the HEKs and the HDFs were separated and homogenized in 500 µL of TRIzol reagent (Invitrogen, Carlsbad, CA, USA) using a microhomogenizer following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus-compatible expression vectors generated from Gateway Cloning were transfected in HEK-293T cells with Lipofectamine 3000 Transfection Reagent (cat. no. L3000001, Invitrogen) along with psPAX2 and pVSV-G viral packaging plasmids (Addgene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2nd generation lentiviral packaging plasmids into HEK 293T cells at 60-80% confluency with 60uL Lipofectamine3000 (Thermo Fisher Scientific; L3000008) and 50uL P3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: HEK-293T and HuTu-80 (CLS, 300218) cell lines were expanded in growth medium (DMEM or DMEM:F12, respectively; Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Approximately 8·106 HEK-293T cells were seeded into T75 flasks previously coated with poly-D-lysine (Gibco™ A3890401). After 16 - 24 h (when cells reached around 90% confluence) ...
-
bioRxiv - Biochemistry 2023Quote: The human embryonic kidney 293EBNA1-6E cell line (HEK 293EBNA1-6E) was adapted to growth in suspension in F17 medium (FreeStyleTM F17 Expression Medium, Gibco), supplemented with 4 mM L-Glutamine (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: For expression analysis of truncated WDR47 constructs HEK cells were transfected with different HA tagged Wdr47 constructs using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Chinese Hamster Ovary (CHO) cells were maintained similar to HEK cells with the following differences: Culture media was IMDM (Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2024Quote: pRT074 was lentivirally packaged in HEK 293T cells (ATCC Cat. No. CRL-3216) DMEM complete medium: DMEM (Gibco, 11965-092) supplemented with 10% FBS (VWR ...
-
bioRxiv - Cancer Biology 2024Quote: Blue Native PAGE was performed using lysates prepared from growing HEK-293T cells according to the manufacturer’s protocol (Thermo Fisher). 1ξ107 cells were collected and lysed using 1x Native PAGE lysis buffer including protease inhibitor cocktail and 1% digitonin ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK-293T cells were transfected with shRNA plasmid and helper plasmids psPAX2 and pMD2.G using Lipofectamine 2000 (Invitrogen #11668027) in Opti-MEM (Invitrogen #22600-050 ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...