Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Recombinant Human Neuropilin 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... diluted 1:3000 in blocking buffer or HRP-labelled goat anti-human IgM (Thermo Fisher Scientific) diluted 1:4000 at 37°C for 1 hour ...
-
bioRxiv - Immunology 2022Quote: ... and 1:5,000 diluted goat anti-human-IgG Fc horseradish peroxidase (HRP) conjugated secondary antibodies (Invitrogen) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD31-APC with human specificity for HUVEC experiments (1:500, Thermo Fisher Scientific, 17-0319-42) together with its IgG1 kappa APC-Isotype control (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng/mL human basic FGF2 (Miltenyi Biotech, 130-093-840) and kanamycin (Gibco, 15160-054). Culture medium was exchanged every 2 days ...
-
bioRxiv - Bioengineering 2023Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-human IgM and IgA (Invitrogen, A18835 and A18781, 1:5,000), rabbit anti-human IgG antibody (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding the ECR of human ADGRB2/BAI2 (aa 1-921) was synthesized by Thermo Fisher GeneArt ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-Human IgG (H+L) Alexa Fluor 488 conjugated (Invitrogen, A-11013, dilution 1:500); Donkey Anti-Mouse IgG H&L Alexa Fluor 647 conjugated (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-Human IgG (H+L) Alexa Fluor 488 conjugated (Invitrogen, A-11013, dilution 1:500). Data acquisition was performed with FACSVerse™ (BD ...
-
bioRxiv - Neuroscience 2024Quote: ... the mean fluorescence intensity (MFI) of Alexa488-coupled goat anti-human IgG (1:500; Life Technologies) was evaluated ...
-
bioRxiv - Cancer Biology 2023Quote: 1 × 105 OCSC1-F2 human OC cells were resuspended in serum-free Opti-MEM (Thermo Scientific) and seeded on trans-well inserts with a polyethylene terephthalate membrane pore size of 8.0 μm (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... A HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA, 88881, Life Technologies) enabled in vitro translation of these constructs ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with a goat anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific). For IgG subclasses and IgM detection ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples with 1×106 isolated human platelets were prepared in binding buffer (Invitrogen, Carlsbad, CA, USA). Hemin and CPR-XL were incubated at the indicated concentrations for 1h at room temperature.
-
bioRxiv - Neuroscience 2024Quote: Human primary Müller cells (P3) after siRNA treatments were incubated with JC-1 dye (#T3168, Invitrogen) at a concentration of 1.0 μg/mL in DMEM at 37 °C for 30 minutes to measure the mitochondrial membrane potential ...
-
bioRxiv - Cell Biology 2024Quote: ... PC3 cells were transfected with cDNA encoding human talin-1 (NM_006289) using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s recommendation ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with goat polyclonal anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific) for 1 hour at room temperature ...
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins were purified using Ni-NTA agarose (Thermo Fisher Scientific), then buffer-exchanged into PBS and concentrated using Amicon Ultra centrifugal filters (MilliporeSigma) ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2021Quote: All recombinant proteins were expressed and purified using Expi293F cells (Life Technologies,) as described in detail previously [34 ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The guide RNAs and recombinant Cas9-NLS protein (Thermo Fisher Scientific, B25642) were transfected into HEK293 T-Rex cells with Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The yield of the recombinant protein was estimated by Qubit 2.0 (Invitrogen) and the degree of purification by SDS-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... resuspended in water and pre-cleared with recombinant protein G agarose (Invitrogen). Immunoprecipitation of lysates was performed after lysis in NP-40 lysis buffer ...
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins were acetone precipitated prior to digestion with recombinant trypsin (ThermoFisher) (1:50 wt/wt. ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant proteins were expressed using the Expi293 Expression system (ThermoFisher Scientific) and purified with HisTrap FF columns (for polyhistidine-tagged spike proteins ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...