Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for Recombinant Human Neuropilin 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... IPs of FLAG-tagged PRRC2B and PRRC2B fragments were performed using anti-DYKDDDDK Magnetic agarose (ThermoFisher Scientific). Beads were mixed with 70 μl of SDS loading buffer (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant fraction containing the GST-tagged constructs were loaded onto Protino Glutathione Agarose 4B (Fisher Scientific) beads and impurities were removed by washing with TBS ...
-
bioRxiv - Cell Biology 2023Quote: MDA-MB-231 clones H2 and C10 carrying endogenously tagged HiBiT-cIAP1 were generated by Thermo Fisher and were used for compound screens ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged ARL15 proteins were immunoprecipitated using 50 μL of Pierce Anti-DYKDDDDK Magnetic Agarose (ThermoFisher Scientific) for 2 hours at 4 ºC ...
-
bioRxiv - Neuroscience 2023Quote: ... The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... His8-tagged TGM2 was first pulled down by BSA-blocked Ni2+-NTA agarose beads (Thermo Fisher Scientific). Next ...
-
bioRxiv - Cancer Biology 2024Quote: MOLT-4 cells expressing HiBiT-tagged CDK9 were cultured in RPMI 1640 medium (Thermo Fisher Scientific, 11875093) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Genetics 2024Quote: ... human for rs2297550 from ThermoFisher.
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then incubated with Alexa 594 goat-anti rabbit secondary antibody at 1:750 and with Alexa Fluor 488 goat anti-human IgG(H+L) at 1:500 (both Invitrogen; in PBS) for 2 h at RT.
-
bioRxiv - Neuroscience 2019Quote: ... iPSCs were cultured on a feeder layer of irradiated mouse embryo fibroblasts using human embryonic stem cell media containing DMEM with F12 (DMEM/F12, 1:1 ratio, Thermo Fisher Scientific) supplemented with 20% Knockout Serum Replacer (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mouse lung fibroblasts (CCL-206, ATCC, Wesel, Germany) or human lung fibroblasts (MRC5, ATCC, CCL-171) were cultured in 1:1 DMEM (Gibco, MD, USA) and Ham’s F12 (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were washed three times with PBS and then incubated with either goat anti-human IgG conjugated with Alexa fluor 488 at a dilution of 1:500 for 1 h (Invitrogen, Carlsbad, CA). The cells were then washed and stained with hoechest-33342 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... 2 million cells were activated with dynabeads human T activator CD3/CD28 at a 1:1 bead to cell ratio (Thermo Fisher Scientific), Staphylococcal enterotoxin B (SEB ...
-
bioRxiv - Cancer Biology 2024Quote: Primary T-cells (CD4 and CD8; 1:1 ratio) were activated for 24 hours with Dynabeads™ Human T-Expander CD3/CD28 (Thermo Fisher) at 3:1 bead ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used (all at 1:100 dilution in immunofluorescence, 1:1000 in immunoblots): CX36 mouse anti-human (Invitrogen, clone 1E5H5), rabbit recombinant ANTI-FLAG M2 antibody (Invitrogen 710662) ...
-
bioRxiv - Immunology 2024Quote: ... highly purified (93-98%) naïve human CD4 T cells were activated using anti-CD3+anti-CD28 Dynabeads (1:1, Thermofisher scientific, cat # 11161D) for 8-24 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... and the bound Arr3_ýC•IP6–Fab7 complexes incubated with HRP-conjugated Pierce recombinant protein L (cat: 32420, Thermofisher, 1:5000 dilution in ELISA buffer) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were transfected with 1 μg/ml of recombinant Tat using a commercial transfection reagent Pro-ject Protein Transfection Reagent Kit (Thermo Scientific Cat. No. 89850) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and the bound NTCP-Fab complexes were incubated with a secondary HRP-conjugated Pierce recombinant protein L (Thermofisher, 1:5000 dilution in ELISA buffer) for 30 min ...