Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for Recombinant Human Neuropilin 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... human BNIP3 (Hs00969291_m1) and human 18S (Hs99999901_s1) were purchased from Applied Biosystems. 18S served as an internal control ...
-
bioRxiv - Microbiology 2022Quote: Human monoclonal antibodies were produced recombinantly in human Expi293F cells (Life Technologies) as described before (83) ...
-
bioRxiv - Cell Biology 2020Quote: ... Ki-67 recombinant rabbit monoclonal antibody (SP6) (Thermofisher, Cat. #: MA5-14520), Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Genetics 2021Quote: ... and Mouse M-CSF Recombinant Protein were from Invitrogen (Carlsbad, CA). Lipopolysaccharides from Escherichia coli O111:B4 was purchased from Sigma (St Louis ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant soluble ACE2 was coated on NUNC Maxisorp plates (Thermo Scientific) at 1µg/well at RT for 3 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse IFN-alpha 2 (Ifna2) recombinant protein was purchased from Affymetrix eBioscience (catalog #14-8312) ...
-
bioRxiv - Biochemistry 2019Quote: ... The recombinant gene was cloned into pFastBac1 expression vector (Life Technologies) for bacmid production ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant Bax was labeled by NBD dye (IANBD amide, Life Technologies) as reported previously (Kale et al. ...
-
bioRxiv - Genetics 2021Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Biochemistry 2021Quote: ... the isolated recombinant EMBacY was transfected into adhesive Sf9 cells (Invitrogen) in 6-well plates ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 U of recombinant Taq DNA Polymerase (Thermo Fisher Scientific, Lithuania) and water to final volume of 10μl ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and incubated on ice for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... We used GFP recombinant rabbit monoclonal antibody (G10362, Thermo Fisher Scientific) at 1:300 dilution and monoclonal anti-GFP ...
-
bioRxiv - Immunology 2021Quote: ... and 1µl of RNaseOUTTM Recombinant Ribonuclease Inhibitor (Invitrogen, Catalogue no.-10777019). 11µl of the cocktail was added to the RNA/primer mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and the lysates were incubated on ice for 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... then treated with recombinant DNaseI (DNA-free DNA removal kit, Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant protein was transiently expressed in Expi293™ (ThermoFisher Scientific, UK) and purified from culture supernatants by an immobilised metal affinity using an automated protocol implemented on an ÄKTAxpress (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD proteins were produced in transfected FreeStyle 293F cells (Invitrogen) and purified by nickel affinity chromatography ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant soluble DPP4 was coated on NUNC Maxisorp plates (Thermo Scientific) at 100 ng/well at RT for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using Taq DNA Polymerase Recombinant kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 μL/sample of recombinant Protein-G-Sepharose-4B beads (ThermoFisher) was washed thrice with IP buffer and added to each sample for equilibration on a rotator for 4h ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were produced using the Expi293F cells (Thermo Fisher Scientific) by transfecting 200×106 of these cells with purified DNA using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant ACE2-Fc (18-615) protein expressed in Expi293F (Life Technologies) cells was chemically biotinylated using EZ-link Sulfo-NHS-Biotin (A39256 ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant sACE2 protein was purified by nickel affinity columns (Invitrogen) and ACE2-Fc was purified using Protein A affinity column (Cytiva) ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ng/ml mouse recombinant LIF (ES cell-tested) (Gibco #A35935). Upon reaching confluence ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Biochemistry 2022Quote: All recombinant proteins were expressed in Escherichia coli BL21 DE3 (Invitrogen), in LB medium ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Microbiology 2022Quote: ... purified CD4+ T cells were maintained for two days in complete RPMI 1640 medium containing recombinant interleukin-2 (IL-2) (300 IU/ml) and phytohemagglutinin (1 μg/ml, Thermo Fisher Scientific), followed by 3 days in the presence of IL-2 alone ...