Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Yeast extract (5 g L−1; UltraPure; Thermo Scientific, USA), Coral Pro Salt (1 g L−1 ...
-
bioRxiv - Cell Biology 2024Quote: ... incubated with 1:5 diluted Accutase (Thermo Fisher Scientific; A1110501) in DPBS for 5 minutes at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained with 5 µg mL−1 DAPI (D1306; Invitrogen). Next ...
-
bioRxiv - Genomics 2024Quote: ... 5 μL of Streptavidin C-1 beads (Thermo Fisher # 65001) was used to capture the Biotin Datp labeled DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... reactions were supplemented as needed with 1-5% DMSO (Invitrogen) and/or 1M betaine (Thermo Scientific) ...
-
bioRxiv - Genomics 2024Quote: 5 μL Streptavidin C-1 beads (Thermo Fisher Scientific 65001) were washed with 300 μL Tween Wash Buffer ...
-
bioRxiv - Biophysics 2024Quote: ... treated with 5 mg ml-1 NHS-Biotin (ThermoFisher Scientific) in 250 mM borate buffer (pH 8.6 ...
-
bioRxiv - Cell Biology 2024Quote: ... Nucleocapsid (1:8000, Cat# MA5-29981, Invitrogen in 5% BSA), Actin (1:10000 ...
-
bioRxiv - Immunology 2022Quote: ... The 40 mg/ml 4-HT stock solution was diluted 1:1 in Kolliphor EL (MilliporeSigma) 59.Before injection the solution was further diluted 1:3 in PBS (Gibco) and warmed to 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and 3 µg/mL (full dose, or diluted to 1/2, 1/4, 1/8) anti-CD28 (MA110172, Thermo Fisher), and cultured in the pre-coated plate for 3 days ...
-
bioRxiv - Paleontology 2020Quote: ... for 3 min at a flow rate of 10 μl.min−1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated 1 hour with 5 μg/mL Hoechst 34580 (stock 5 mg/mL in H2O) (Thermo Fisher) and anti-mouse Alexa 647 in PBS+.
-
bioRxiv - Paleontology 2023Quote: ... for 3 min at a flow rate of 10 μl.min-1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
bioRxiv - Microbiology 2020Quote: ... 1/10 volume of 3 M Sodium Acetate (pH 5.2) and 1 μl of GlycoBlue (Life Technologies). The precipitate was pelleted by centrifugation (30 min ...
-
bioRxiv - Genetics 2023Quote: ... Induction 3 Medium (StemPro-34 complete media, 20 mM HEPES, 1% GlutaMAX, 1% Penicillin-Streptomycin (Life Technologies); 213 μg/mL 2-phosphate Ascorbic Acid (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were blocked with 3% bovine serum albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco #PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... A Lsm12-KO cell line of HEK293 cells was generated with Synthego’s chemically modified sgRNA 5’-CCAGAAUGUCCCUCUUCCAG-3’ and GeneArt Platinium Cas9 nuclease (ThermoFisher Scientific) that were transfected together into cells using Lipofectamine CRISPRMAX Cas9 transfection reagent (ThermoFisher Scientific).
-
bioRxiv - Genetics 2021Quote: The SNP STARRseq library (100ug plasmid DNA/replica) was transfected into LNCaP cells (5 × 107 cells/replica; 3 biological replicas) using the Neon Transfection System (Invitrogen). Cells were grown in RPMI 1640 medium supplemented with 10% FBS and collected 48hrs post-electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Neuroscience 2022Quote: ... Recordings were made with patch pipettes (3-5 MΩ) containing aCSF and 10 µM alexa-594 (Thermofisher, Waltham, MA, USA) and CSFcNs were targeted under visual guidance using their fluorescence ...
-
bioRxiv - Neuroscience 2021Quote: ... We washed the cells 3 times for 5 minutes each with 1X PBS and mounted with ProLong Gold Antifade Mountant with DAPI media (Invitrogen) to preserve the cells for imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in Milli-Q water for 3 × 5 minutes and cover slipped with ProLong Gold Antifade (Invitrogen, P36930).
-
bioRxiv - Neuroscience 2021Quote: ... Tet-on 3’ UTR HP and 5’ UTR HP DG NSCs were brought in suspension by incubating with 0.25% trypsin (Gibco #15090) in Versene (Gibco #15040 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from Hela cells (n = 3) subjected to EBSS-induced autophagy and treatment with 5 μM UNC0638 for 12 hours using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3′ primer (5′-AGGGCTCTTCGGCCAGCRAAAGCAGG) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted approximately 10,000-fold and used as a template for quantitative PCR (qPCR) ...
-
bioRxiv - Bioengineering 2020Quote: ... Separation was performed on an Aquasil C18 column (250 cm x 3 mm, 5 µm particle size; Thermo Fisher Scinetific) at a flow rate of 1 ml/min ...
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were washed with 1X PBS 3 times for 5 minutes and then mounted with Prolong Glass Antifade mountant (Invitrogen). Confocal Z-stack images were acquired using Nikon SoRA spinning disk microscope ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were washed at least 3-5 times with TBSTX buffer and incubated with the appropriate Alexa fluorescent secondary antibodies (Invitrogen). Sections were washed 3-5 times with TBSTX buffer and then mounted on Superfrost slides (Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pelleted down at 2,500 rpm for 3 mins and were washed 5 times with ice-cold DPBS (Gibco #14200075). The pellets were finally dissolved in DPBS and were counted by haemocytometer using Trypan Blue stain (Gibco #15250061) ...
-
bioRxiv - Immunology 2021Quote: ... forward 5’-TAACCGGTATGGGCATACTGAGCTTTCT-3’ (contains the AgeI restriction site) and reverse 5’-TAGGATCCAATCCTGTTCTGGTCGTCG-3’ (contains the BamHI restriction site) and the PCR product was cloned into pCRBlunt (Invitrogen) and sequenced ...
-
bioRxiv - Biophysics 2021Quote: ... we wash the blot 3 times with TBST and soak for 5 min in chemiluminescent substrate (Thermo Scientific catalog # 34080).
-
bioRxiv - Microbiology 2021Quote: ... using a HA-specific primer (5’-GTCCTTGCGACTG-3’) and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... using a HA-specific primer (5’-GTCCTTGCGACTG-3’) and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... ISR1 CDS with a 5’ EcoRI restriction site and 3’ BamHI restriction site was amplified using Phusion (Thermo Fisher Scientific) and ISR1 start + EcoRI FOR and ISR1 no stop + BamHI REV primers (Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then washed 3 × (MBL2 wash buffer) and stained with DAPI (600 nM in MBL2 wash buffer; 5 min, RT; ThermoFisher) before imaging ...
-
bioRxiv - Cancer Biology 2020Quote: 1 μg total RNA from healthy and OS samples was used for 5’ and 3’ RACE reactions with the FirstChoice RLM-RACE kit (Ambion) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Cell Biology 2021Quote: ... so that 50 μg of total protein could be mixed with 5% Coomassie brilliant blue G-250 before loading on a 3-12% Bis-Tris BNE gel (Invitrogen). After electrophoresis (2.5 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... slides were washed 3 times in PBST for 5 minutes each and mounted using ProLong Diamond Antifade Mountant (Invitrogen, P3696). Coverslips were carefully placed over the sections ...
-
bioRxiv - Molecular Biology 2022Quote: ... NC) or plasmid with HAX1 gene with tag on 3’end or 5’end of the gene (LipofectamineTM2000, ThermoFisher Scientific). Cells were detached and seeded on 100mm plates to grow single colonies (selection ...
-
bioRxiv - Neuroscience 2022Quote: ... Coverslips were rinsed 3 times for 5 minute intervals with PBS and mounted on microscope slides (Fisher Scientific, 22-178277) using ProLong Glass Antifade Mountant (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’L1-3’L2 orientation were inserted via recombination into a pCS2+ Gateway-converted vector (Custom vector conversion kit; Invitrogen). Details of the Gateway plasmid are available upon request ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Immunology 2022Quote: ... complementary DNA (cDNA) was generated from extracted mouse plasma RNA using primer YB383 5’-TTTTTTTTTTTTTTTTTTTTTTTTRAAGCAC-3’ and enzyme Superscript III (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were again washed 3× in PBS for 5 min each and mounted onto slides using ProLong Gold Antifade (Invitrogen). Images of stained mTECs were obtained using an SP8 (Leica Microsystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were dried for 30 mins in a 37°C incubator and washed 3×5 min with 0.1% TritonX-100 in PBS (PBST) and incubated in 10% Horse Serum (ThermoFisher, #26050070), 0.4% TritonX-100 in 1x PBS (blocking buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... Rosettes were rinse 3 times in distilled water and stained 20 min in a 5% (v/v) Lugol’s iodine solution (Fisher Scientific). After 3 rinses in distilled water ...