Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Neuroscience 2024Quote: ... stained with TO-PRO-3 diluted 1:1000 in DPBS and 1 µM Hoechst 33342 (Thermo Fisher 62249) nuclear counterstain for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 3 μg mRNA at a mass ratio of 1:1 using Lipofectamine MessengerMAX (Invitrogen) according to the manufacturer’s guide ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 x 10 ^5 TC32 or A673 cells (mixed in a 1:1 solution of growth factor reduced Geltrex [Life Technologies, catalog number A1413202] with PBS) were injected into the mouse in a peritibial location.
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Neuroscience 2021Quote: ... and Standard Control (5’ CCTCTTACCTCAGTTACAATTTATA 3’) MOs (GeneTools) were diluted in distilled water and co-injected with Cascade Blue labelled dextran (Molecular Probes) into one- to two-cell wild-type (Tübingen ...
-
bioRxiv - Neuroscience 2020Quote: ... The slides were then washed in 1X PBS 3 times for 5 minutes before being incubated with Hoechst 33342 (Thermo Fisher) for 5 minutes before being washed again and coverslipped with prolong diamond (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both halves of MF filters and entire SF filters were transferred independently to 5 mL Eppendorf tubes and 3 mL of autoclaved PBS pH 7.4 (1X) (Gibco™, Thermo Fisher) was added ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Molecular Biology 2020Quote: ... We also sequentially removed the 5’ and 3’ viroid moieties from this latter plasmid via PCR with the phosphorylated primers (T4 polynucleotide kinase, Thermo Scientific) D3606 and D3285 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MommeD43 mutation (A667E) was introduced by oligonucleotide-directed mutagenesis (5’ CTGTGCCCATTGAAAAGCTGGAT AGG; 3’ CCTATCCAGCTTTTCAATGGGCACAG) and ligated into the pFastBac Htb vector (Life Technologies). Bacmids were prepared using the Bac-to-Bac system ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed 3 times in 1xPBS for 5 minutes at room temperature and mounting was done in ProLong Gold with DAPI (Invitrogen, P36935). Images were collected on a LSM800 confocal microscope (Zeiss ...
-
bioRxiv - Genomics 2020Quote: ... 1,000,000 wild-type (J1) mESCs were transfected with 1µg of each 5’ and 3’ sgRNA-Cas9-mCherry plasmids using Lipofectamine 2000 (Thermo Fisher Scientific). After 24hrs of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μg of reporter plasmid and 15 ng of Cre-plasmid was mixed with 3 μL Lipofectamine LTX reagent (Invitrogen, #15338100), 1.5 μL PLUS reagent and 100 μL Opti-MEM following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Larvae were let to recover in E3 for 3 hours and 30 minutes and then incubated for 45 minutes in 5 µM CellROX® Deep Green Reagent (Invitrogen) solution diluted in E3 without methylene blue ...
-
bioRxiv - Plant Biology 2020Quote: ... Rapid amplification of the 5’ and 3’ cDNA ends (RACE) was subsequently carried out by using the First Choice RLM-RACE kit from Ambion (USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... targeting the TLR3 gene (5’-CCUGAUGAUCUUCCCUCUAACAUAA-3’) and Stealth RNAi siRNA negative control med GC Duplex #2 were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: Samples were reconstituted in 3% ACN/ 5% FA prior to LC-MS/MS analysis on a Fusion Lumos or Orbitrap Exploris 480 (Thermo Scientific). A pool of two IPs was injected twice as a technical replicate ...
-
bioRxiv - Microbiology 2020Quote: ... An amplicon was amplified encoding the S protein with a 19 amino acid truncation of the cytoplasmic tail using primers containing flanking 5’-KpnI and 3’-XhoI sites and cloned into pcDNA6 (Invitrogen, Inc.). To construct the ACE2 expression vector pLenti.ACE2-HA ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 µg of protein was subjected to nanoflow liquid chromatography on an EASY-nLC system (Thermo Fisher Scientific, Bremen, Germany) on-line coupled to an Q Exactive HF quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of the RNA preparations were subjected to RT with primer PI (5’-AGGCTTGCAAACGGAGTCTAA-3’) and RevertAid reverse transcriptase (Thermo Scientific). RT products were amplified by PCR with Thermus thermophilus DNA polymerase (Biotools ...
-
bioRxiv - Cell Biology 2021Quote: ... the peptides were resuspended in 3% formic acid (FA)/5% acetonitrile (ACN) and loaded onto a nanoLC system (RSLCnano, Thermo Scientific). First ...
-
bioRxiv - Cell Biology 2020Quote: ... alongside Chameleon Duo Protein Ladder (3 μL/lane; LiCOR, 928-60000) or PageRuler Protein Ladder (5 μL/lane; Thermo Scientific, 26616) and run in pre-chilled 1X MOPS Buffer (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytospins, Matrigel cultures were blocked with 3% bovine serum albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco #PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Groups of 16 larvae at 5 dpf from all corresponding genotypes (N = 3 per genotype) were collected and stored in RNAlater (Thermo Fisher) until use ...
-
bioRxiv - Molecular Biology 2022Quote: ... lysine to arginine (residue K816), and serine to alanine (residues S820, S824, S825) within 5’ GATGGTATTTTGCCCAGGAGTCAGCATGAATCCAGT 3’ d812-827a were purchased from Thermo Scientific and ligated into the backbone ...
-
bioRxiv - Genetics 2022Quote: ... alongside Chameleon Duo Protein Ladder (3 μL/lane; LiCOR, 928-60000) or PageRuler Protein Ladder (5 μL/lane; Thermo Scientific, 26616) and run in pre-chilled 1X MOPS Buffer (Thermo ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were washed in PBS for 5 minutes X 3 times and mounted with ProLong Gold Antifade Mountant (Thermo Fisher Scientific) and stored at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 1µM of either control or CARP2 specific siRNA- sequence is − 5’ UGACAUCUCUACCGAAAUG 3’ using RNAimax (13778-075, Thermo Fisher Scientific) as per manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Blots were then washed three times for 5 min in PBS-T.3 and developed with ECL reagents per manufacturer instructions (SuperSignal West Pico Chemiluminescent Substrate; Thermo Fisher). FW blots were visualized with a LAS-3000 digital imaging system (Fujifilm ...
-
bioRxiv - Molecular Biology 2021Quote: A biotin-labeled circPTPN12 probe and an unlabeled probe (5’-AGGCCATTACAATGATCTGCAATGAATAC-3’, General Biosystems, Chuzhou, China) were separately incubated with streptavidin-coated magnetic beads (Thermo Scientific), followed by incubation with the lysates of HEK-293T cells transfected with circPTPN12 plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... All 27 samples from 3 groups and 6 GIS were divided and labeled using two sets of 5 mg 11 plex TMT reagents (Thermo Scientific A34808 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both sections and co-cultures were blocked with 3% Bovine Serum Albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acids were extracted on ice-cold lysis buffer [5:3:2 ratio of methanol-acetonitrile-water (Fisher Scientific, Pittsburgh, PA)] containing 3 µM of amino acid standards [Cambridge Isotope Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... Probe 2 (mutation; 5’ FAM – CTC CCG CCT GAT T 3’) and Platinum Quantitative PCR SuperMix-UDG w/ROX (Life Technologies). The products were amplified and analysed on an ABI StepOne PCR machine.
-
bioRxiv - Molecular Biology 2021Quote: ... cDNAs were quantified by qPCR using the prima-QUANT CYBR Master Mix (Steinbrenner Laborsysteme) in a QuantStudio 5 or 3 Real-Time PCR System (Applied Biosystems). The primers used are listed in Suppl ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were washed 3 times in PBS for 5 minutes before being incubated with AlexaFluor 488 or AlexaFluor 568 (Thermo Fisher) rabbit or mouse secondary antibodies for 1 hour at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Blots were washed in TBST (3 x 5 min) and developed using SuperSignal™ West Dura Extended Duration Substrate (ThermoFisher Scientific) and an ImageQuant Gel imager (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: A TrueGuide crRNA directed against exon 1 of Hs IRS2’s coding region (target DNA sequence: 5’-TCG AGA GCG ATC ACC CGT TT −3’, Assay ID number: CRISPR850215_CR, Thermo Fisher Scientific) was annealed to the TrueGuide tracrRNA (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... were cultured in DMEM-F12 containing PS and 5% FBS for CHO cells or 3% FBS for CHO-ldlD cells and transfected using Lipofectamine 2000 (Thermo Fisher) following standard protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The extracted lipids (5 μL/injection) were separated on an Acclaim PepMap 100 C18 column (3 μm, 1.0 × 150 mm, Thermo Fisher Scientific) at a flow rate of 0.045 mL/min with a linear gradient of solvent A and solvent B ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM reverse internal control primer [5’-CTTGTTGAGAACAAACTCCTGCAGCT-3’] and Dream Taq Hot Start Green PCR Master Mix (Thermo Fisher Scientific). Cycling conditions were 3 min at 95°C ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Immunology 2021Quote: ... RRV cDNA was generated from 10 μl of serum derived RNA or 1 μg of tissue derived RNA using a sequence-tagged (indicated with lower case letters) RRV-specific RT primer (5′-ggcagtatcgtgaattcgatgcAACACTCCCGTCGACAACAGA-3′) with SuperScript IV reverse tran-scriptase (Life Technologies). RRV genomes were quantified by RT-qPCR using a tag sequence-specific reverse primer (5′-GGCAGTATCGTGAATTCGATGC-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... (Cai et al., 2009), or Kif15 (5’-GGACAUAAAUUGCAAAUAC-3’, 24 h) (Vanneste et al., 2009) using Lipofectamine RNAiMAX (13778075, Thermo Fisher) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... and 5’-GCTCCAGAGCAGAATGAGCTA-3’ (Reverse).ChIP samples were analyzed by real-time qPCR with the SYBR-Green Master Mix system (Life Technologies).