Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... then reverse transcribed into cDNA using a TSO primer (59-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-39) and RT maxima reverse transcriptase (Thermo Fisher Scientific). Amplification of cDNA was performed using an ISPCR primer (59-AAGCAGTGGTATCAACGCAGAGT39 ...
-
bioRxiv - Neuroscience 2021Quote: ... First-strand cDNA was synthesized from 2 µg of total RNA using oligo(dT) primer and Superscript IV reverse transcriptase (RT) according to the manufacturer’s instructions (Life Technologies). First-strand cDNA samples were diluted 1:3 and 5 µL was used as template ...
-
bioRxiv - Neuroscience 2019Quote: ... First-strand cDNA was synthesized from 2 micrograms of RNA using oligo(dT) primer and Superscript IV reverse transcriptase (RT) according to the manufacturer’s instructions (Life Technologies). First-strand cDNA samples were diluted 1:5 and 5 μl was used as template ...
-
bioRxiv - Immunology 2020Quote: ... 100 ng to 1 µg total RNA was subjected to reverse transcription using random primers and M-MLV RT (Invitrogen). Specific primer pairs for each gene were designed ...
-
bioRxiv - Genetics 2020Quote: ... First-strand cDNA was synthesized from 2 micrograms of RNA using oligo(dT) primer and Superscript IV reverse transcriptase (RT) according to the manufacturer’s instructions (Life Technologies). First-strand cDNA samples were diluted 1:10 and 5 μl was used as template ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using 1 ug of RNA reverse transcribed for 50 min at 42°C using oligo(dT) primer (IDT) and SuperScript II RT (Invitrogen). For qPCR analysis ...
-
bioRxiv - Microbiology 2022Quote: ... Extracted vRNA was reverse transcribed using a 1:1 ratio of universal influenza primers (53)(S2 Table) and Maxima RT (Thermofisher) per protocol instructions ...
-
bioRxiv - Genomics 2023Quote: ... 23 μL were mixed with reverse transcription master mix (1.25 μL of 10 μM scc primers, 10 μL Maxima RT buffer (ThermoFisher #EP0753), 5 μL dNTPs (New England Biolabs #N0447L) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was converted to cDNA using multiplexed RT primers and High Capacity cDNA Reverse Transcription Kit (ThermoFisher; Carlsbad, CA). miRNAs were then quantified using individual TaqMan assays on an ABI QuantStudio 7 real time PCR machine (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was performed with specific primers (Table S1) using the QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher Scientific) and cycling conditions for PCR were 50°C for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Microbiology 2022Quote: ... a DNA fragment comprising the sgRNA target region was amplified by PCR using primers AATAGAGCAAACAACAGGAGGC and GAGTACTGACCTGGTCCTTTGG and the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific).
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... PCR reactions using primers found in Table 1 were carried out using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher, F548S), following the manufacturer’s instructions and using an Eppendorf Mastercycler Nexus Thermal Cycler with the following program ...
-
bioRxiv - Genomics 2020Quote: ... were amplified via the polymerase chain reaction (PCR) using primers to facilitate subsequent ligation of the PCR products into the glutathione-S-transferase encoding vectors (Life Technologies). The M.MspI PCR product was initially inserted into the BamHI and EcoRI sites in pGEX 2T ...
-
bioRxiv - Biochemistry 2023Quote: ... S4) respectively were PCR amplified by specific primers (Table S2) using Phusion® High-Fidelity PCR Master Mix (Thermo Fisher Scientific) from genomic DNA template and sub-cloned by restriction cloning into GFP expression plasmids pPD95_79 and pPD95_81 ...
-
bioRxiv - Bioengineering 2023Quote: ... The relative abundance of EV miRNA was determined by TaqMan PCR using TaqMan Universal PCR Master Mix II and TaqMan primers and probes from Applied Biosystems. hsa-miR-423-3p was used as an endogenous reference miRNA ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting assembled amplicon was then selectively amplified in the second PCR reaction using outer primers of the homology arms and cloned into the pCR-Blunt vector using Zero Blunt PCR cloning kit (ThermoFisher Scientific). Repair templates produced by OE-PCR were ultimately used for transfections.
-
bioRxiv - Cancer Biology 2024Quote: ... mRNA levels were quantified by quantitative real-time polymerase chain reaction (qRT-PCR) using the following PCR primers on a ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Primer sequences ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA was synthesized using equal quantities of RNA (143 ng) using SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific). Expression levels of vrille 12 ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-qPCR was assessed on a Real-time PCR StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). PCR thermal cycling conditions had an initial step at 94 °C for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Semi-quantitative radioactive PCR (RT-PCR) was carried out in the presence of 32P-dCTP with AmpliTaq DNA polymerase (Thermo Fisher), and real-time quantitative RT-PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Semi-quantitative radioactive PCR (RT-PCR) was carried out in the presence of 32P-dCTP with AmpliTaq DNA polymerase (Thermo Fisher), and real-time quantitative RT-PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative RT-PCR was performed and analyzed according to the protocols of StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific) with 2× SYBR green master mix (Quanta Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNAs were subjected to RT-PCR using the Dream Taq Green PCR master mix (Thermo Scientific, San Jose, CA, USA). Quantitative real time PCR (q-PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse-transcribed with High Capacity Kit (Life Techonologies) and analyzed by quantitative RT-PCR with a Step One Real-time PCR system as described above (Applied Biosystems).
-
bioRxiv - Neuroscience 2019Quote: ... H3R and D1R were amplified by real-time (RT)-PCR using 1 μL cDNA and power SYBER green PCR Master Mix (Applied Biosystems) on a 7500 Real Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA samples were subjected to qRT-PCR analysis using AgPath-ID One-Step RT-PCR Kit (Applied Biosystems; Thermo Fisher Scientific). The primer and probe sequences targeting SARS-CoV-2 N gene included ...
-
bioRxiv - Microbiology 2020Quote: ... RNA samples were subjected to qRT-PCR analysis using AgPath-ID One-Step RT-PCR Kit (Applied Biosystems; Thermo Fisher Scientific). The primer and probe sequences targeting SARS-CoV-2 N gene included ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted TNA samples were analyzed by reverse transcription quantitative PCR (RT-qPCR) using TaqMan probes on the QuantStudio 6 Flex Real-Time PCR System (ThermoFisher Scientific) as described previously (Osman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was reverse transcribed and viral genome copies quantified by real-time PCR using the SuperScript III OneStep RT-PCR Kit (Invitrogen Life Technologies) and the StepOne Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 subgenomic RNA of the E gene was reverse transcribed and copy numbers quantified by real-time PCR using the SuperScript III OneStep RT-PCR Kit (Invitrogen Life Technologies) and the StepOne Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCR was performed using Sensitive RT HS-PCR Mix SYBR (A&A Biotechnology) on One Step Plus Real-Time PCR System (Applied Biosystems). The list of qPCR primers is provided in Table S8.
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative RT-PCR was performed according to the protocol of Power SybrGreen PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The detailed protocol is described in Table S3.
-
bioRxiv - Neuroscience 2022Quote: ... Real-time polymerase chain reaction (RT-PCR) was performed on a 7500 Real-time PCR System (Applied Biosystems, Carlsbad, CA, USA) with Universal SYBR Green Master Mix (4913914001 ...
-
bioRxiv - Microbiology 2022Quote: The reverse transcription quantitative PCR (RT-qPCR) assays for the detection of TMPRSS2 were performed using the Quantstudio 5 Real-time PCR system (Applied Biosystems). Premixes were prepared for each amplification reaction ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) reactions were implemented with Platinum™ SYBR™ Green qPCR SuperMix - UDG (Invitrogen, Thermo Fisher Scientific) using the ABI 7500 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) reactions were implemented with Platinum™ SYBR™ Green qPCR SuperMix - UDG (Invitrogen, Thermo Fisher Scientific) using the ABI 7500 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time analyses by two-step RT-PCR was performed for quantification of miRNA on a 7500 REAL TIME PCR SYSTEM (Applied Biosystems) or Bio-Rad CFX96TM real time system using Applied Biosystems Taqman chemistry based miRNA assay system.
-
bioRxiv - Immunology 2020Quote: Single cells were sorted in 96-well PCR plates in 9 µl of RT/pre-amp mix from the CellsDirect One-Step qRT-PCR Kit (Life Technologies) and were kept at −80°C at least overnight ...
-
bioRxiv - Microbiology 2020Quote: ... All rRT-PCR testing was done using Superscript III One-Step RT-PCR System with Platinum Taq Polymerase (Thermo Fisher Scientific). Each 25-μL reaction contained 12.5 μL of the reaction mix ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR assay was performed using the AgPath-ID One-Step RT-PCR Buffer and Enzyme Mix (Life Technologies, Carlsbad, CA). AgPath-ID One Step RT PCR reactions were carried out in 20µl reactions with 1X RT-PCR Buffer ...
-
bioRxiv - Immunology 2022Quote: ... To evaluate the expression levels of certain genes we used TaqMan MGB gene expression assays and TaqMan Universal PCR Master Mix on Viia7 RT-PCR machine (Applied Biosystems). Gene expression was standardised to an endogenous reference gene 18s rRNA (Hs99999901_s1 ...
-
bioRxiv - Plant Biology 2020Quote: ... To confirm that ndufb10 and ndufa5 KO lines were lacking target gene expression Reverse-Transcriptase PCR (RT-PCR) was performed on cDNA (RevertAid Reverse Transcriptase; Thermo Scientific) synthesized after RNA extraction.
-
bioRxiv - Molecular Biology 2020Quote: Real time analyses by two-step RT-PCR was performed for quantification of miRNA and mRNA levels on a 7500 REAL TIME PCR SYSTEM (Applied Biosystems) or Bio-Rad CFX96™ real time system using Applied Biosystems Taqman chemistry based miRNA assay system ...
-
bioRxiv - Immunology 2020Quote: ... and 5’-AATGGGAAGTCACGAAGGTG-3’(reverse) and quantitative real-time RT–PCR was conducted on a StepOne Plus PCR instrument (Applied Biosystems). The NF-κB-luciferase (Luc2p ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1:10 cDNA dilution was used for each reaction of quantitative RT-PCR analysis performed on an ABI Prism HT 7900 real-time PCR detection system (Applied Biosystems) equipped with SDS software version 2.4 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed using a Fast SYBR Green Master Mix using the OneStep instrument (Applied Biosystems). The obtained values were normalized to either HPRT1 or GAPDH genes ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded in technical quadruplicates for q-RT-PCR on a QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher, 4485691). The ΔΔCT method was used to provide gene expression values after normalising to the known reference gene B2M ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded in technical quadruplicates for q-RT-PCR on a QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher, 4485691). The ΔΔCT method was used to provide gene expression values after normalising to the known reference gene B2M ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We did One-step real-time RT-PCR (Step-One Plus real-time PCR thermocycler, Applied Biosystems, Foster City, CA, USA), using total nucleic acids extracted by Trizol® (Invitrogen ...