Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Relative miRNA expression between stem and differentiated samples was assessed via RT-qPCR with the miRCURY LNA™ Universal RT microRNA PCR system (Exiqon) and a StepOnePlus thermocycler (Applied Biosystems). The following miRNA LNA qpcr primer sets (Exiqon ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-qPCR was performed using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (12574-026, Invitrogen). Each 25 μL reaction contained 5 μL of sample ...
-
bioRxiv - Microbiology 2021Quote: RusV-specific RNA was detected by TaqMan RT-qPCR using the AgPath-ID One-Step RT-PCR reagents (Thermo Fisher Scientific, Germany) along with a modified primer/probe set targeting the p200 ORF 2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-qPCR analysis was performed using Power SYBR™ Green RNA to CT™ 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: Quantification of the N gene in the eluate was performed by real-time reverse-transcription (RT-qPCR) using SuperScript™ III Platinum™ One-Step Quantitative RT-PCR System (Invitrogen) as described previously with minor modifications (26) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of extracted RNA samples were determined in one-step RT-qPCR using AgPath-ID one-step RT-PCR (Applied Biosystems, UK) with the following cycle conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed using the RT-PCR Kit (Seven, Beijing, China) on the Quant Studio 3 (Thermo Fisher Scientific, Massachusetts, USA), according to the manufacturer’s procedures ...
-
bioRxiv - Cancer Biology 2023Quote: Transcript levels were measured using quantitative RT-PCR by reverse transcribing total RNA to cDNA (Maxima H Minus RT, Thermo Fisher Scientific), then using fast SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... primers against the V3–V4 hypervariable region of the 16S gene (CCTAYGGGRBGCASCAG forward primer; GGACTACNNGGGTATCTAAT reverse primer).41 PCR was done using AmpliTaq Gold 360 master mix (Life Technologies, Mulgrave, Australia) following a two-stage PCR protocol (29 cycles for the first stage ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of CRK2 was amplified by PCR (forward primer: ATGAAGAAAGAACCTGTCC, reverse primer: TCTACCATAAAAGGAACTTTGTGAG) and inserted into pDONRzeo (Invitrogen; Thermo Fisher Scientific), then transferred to the pBm43GW (Invitrogen ...
-
bioRxiv - Plant Biology 2019Quote: ... The promoter region of CRK2 was amplified by PCR (forward primer: GGTTTTAGATCGTGTTAGATATATCA, reverse primer: TTTGTTTTGTTTGATTGAGAAA) and inserted into pDONR4R1 (Invitrogen; Thermo Fisher Scientific), then transferred to pBm43GW ...
-
bioRxiv - Physiology 2020Quote: All forward and reverse quantitative PCR (qPCR) primers (Table 1) were designed using Primer Express 3.0.1 (Applied Biosystems, ThermoFisher Scientific, Wilmington, DE, USA). Primers were designed using sequences from the brook trout transcriptome from Sutherland et al ...
-
bioRxiv - Microbiology 2022Quote: ... difficile was PCR-amplified (forward primer: ATGTGTAGTGAACAAAAATTTTTTATATGT, reverse primer: CAGTTCAGCCTTCCATAATCCATG) and TA cloned into the expression plasmid pTrcHis2 TOPO (Thermofisher, Carlsbad CA, USA), in-frame with the C-terminal myc-6XHis and Myc tags ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized by reverse transcription from 2 mg RNA with oligodT 15 primers and SSII RT enzyme (Invitrogen). qPCR was performed on a 7500 Fast System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... total RNA was retrotranscribed by using random hexamer primers and the RevertAid RT Reverse Transcription Kit (ThermoFisher Scientific, #K1691). Thermal profile and qPCR analysis to obtain absolute mRNA copy number/50 ng of sample of selected genes are reported elsewhere (66) ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was synthesized using a 2:1 ratio of random primers to Oligo(dT) with SuperScript IV RT (Invitrogen). qPCR was performed with PerfeCTa SYBR Green FastMix for iQ (Quanta Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... the adapter-ligated RNA was used for cDNA synthesis using 0.25 µM of RT primer (Table S5) and 10 units/µL of Superscript III (Invitrogen) at 50 °C for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 μg of total RNA was used to synthesize complementary DNA using random primers (SuperScript II RT; Invitrogen). For quantitative PCR ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μg of RNA was used to generate cDNA using random hexamer primers and RT Superscript III following the manufacturer’s protocol (Invitrogen). The qPCR was performed using primers that were validated for efficiency ...
-
bioRxiv - Plant Biology 2024Quote: ... The cell pellet was overlaid with 143 µL of 70% nitric acid (trace metal grade, A467-500, Fisher Scientific) and incubated at 65°C for 16 h before dilution with 9.5 mL Milli-Q H2O to a final nitric acid concentration of 2% (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR reaction was set up by mixing 5 μl of 2X Power Syber® Green PCR Master Mix (Applied Biosystems, USA), 0.5μl of 10 μM each of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR for each sample was set up in triplicate 25 μl reactions employing the DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, USA), with 0.25 μmol L–1 of forward and reverse primer each and 2 μl DNA template ...
-
bioRxiv - Immunology 2023Quote: ... mRNA gene expression was determined using SYBR Green RT-PCR on the cDNA template and PCR was performed using StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, Massachusetts, USA). The mRNA expression of each gene was evaluated using the comparative Ct (ΔΔCT ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative reverse-transcription PCR (q-RT-PCR) was performed on a Step One Plus Real Time PCR System (Applied Biosystems, Foster City, CA, USA) using TaqMan gene expression assays (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and Cg specific primers in a 20 μl PCR reaction using High Fidelity Platinum PCR Supermix (Life Technologies, Carlsbad, CA) and amplified by 40 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: The PCR products were purified to remove unincorporated primers and dNTP’s using the PCR purification kit (Purelink PCR purification kit, Invitrogen, USA). The purified products were processed for sequencing on a next generation sequencer platform @ 40X coverage (MiSeq ...
-
bioRxiv - Genomics 2020Quote: ... PCR were performed with primers ordered from IDT using either Phusion U DNA Polymerase Green MultiPlex PCR Master Mix (ThermoFisher) or Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... real-time quantitative PCR analysis with a gene specific primer pair using SYBR green PCR mix (Applied Biosystems, cat: 4385612) was performed and data was analysed on the Applied Biosystems ViiATM 7 Real-Time PCR System ...
-
bioRxiv - Microbiology 2022Quote: ... These 2 reaction products were then combined in a second PCR reaction with primer pairs 53 + 56 and the resultant DNA cloned into pCR-Blunt (Invitrogen) before being excised using XbaI + EcoRI and cloned into XbaI + EcoRI cut pSGRJFH1luc ...
-
bioRxiv - Genetics 2021Quote: ... the PCR products from either primer pairs 6/7 or 9/10 with the plasmid vector pCR 2.1 (Thermo Fisher) followed by transformation of One Shot Top 10 chemically competent cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... Primer to be used for quantitative reverse transcription-PCR (qRT-PCR) were designed using the Primer Express 3.0 software (Applied Biosystems) and efficiencies were validated prior to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... The kinesin-1 motor domain was PCR amplified from cDNA using gene-specific primers and cloned into the pCR-XL-2-TOPO vector (Invitrogen) as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR (qPCR) was performed using specific primers (0.2µM concentration and SYBR Green PCR Master Mix (Applied Biosystems, #4309155) on the Mastercycler RealPlex2 (Eppendorf) ...
-
bioRxiv - Immunology 2021Quote: ... About 1.4µg of DNase-treated total RNA was set aside for reverse transcription against (-)RT controls using the high capacity cDNA reverse transcription kit (Thermo Fisher™). Codon optimized RBD gene expression was assessed against a cells only control using qPCR and normalized to human 18S rRNA gene levels by the delta delta Ct method (Livak and Schmittgen ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR was set up with quadruplicate technical replicates using PowerUP™ SYBR® Green Master Mix (Applied Biosystems, Carlsbad, CA, USA). The template cDNA was diluted 5-fold and used for RT-qPCR using a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... FACS buffer was used to wash the cells followed by fixation for 20 min at RT using Foxp3/Transcription Factor Staining Buffer set (Thermo Fisher Scientific). Surface-stained cells were washed ...
-
bioRxiv - Systems Biology 2020Quote: ... The Taqman method was used for real-time PCR with primers from Life technologies. The expression of mRNA was normalized to the geometrical mean of 3 house-keeping genes ...
-
bioRxiv - Cell Biology 2020Quote: ... primers (Table 1) and Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific) were used in standard conditions and relative RNA quantification was normalized to the housekeeping gene GAPDH.
-
bioRxiv - Developmental Biology 2019Quote: ... We performed qRT-PCR with bcd-specific primer pair using SYBR Green (Thermo Fisher) protocol and the housekeeping gene rpl32 was used as internal reference ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cancer Biology 2022Quote: ... real-time PCR for genes was performed using individual gene Taqman primers (Applied Biosystems) with an ABI 7500 real-time PCR system ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with gene specific primers on a 7900HT real-time PCR machine (Applied Biosystems). Statistical significance was determined by Students t test based on triplicated experiments.
-
bioRxiv - Microbiology 2020Quote: ... The backbone of pENTR plasmid was amplified by PCR using primers pENTR_gibson_backbone_F and pENTR_gibson_backbone_R from the pENTR-D-TOPO cloning kit (Invitrogen). The resulting PCR product was subsequently treated with DpnI to remove methylated template DNA ...
-
bioRxiv - Immunology 2022Quote: ... and target specific TaqMan real-time PCR assay primer probes (ThermoFisher Scientific, Waltham, MA). Viral burden was determined by quantitative real-time RT-PCR on lung RNA for viral matrix protein (M1 ...
-
bioRxiv - Genetics 2019Quote: ... PCR-based primer panels were designed with Ion AmpliSeq™ Designer (Thermo Fisher Scientific) to amplify all exons and flanking regions (10 bp ...
-
bioRxiv - Physiology 2020Quote: ... qRT-PCR experiment was performed by Taqman Gene Expression Assay primers (Thermo Fisher Scientific) in triplicates using LightCycler 480 Real-Time PCR System (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2020Quote: ... using TaqMan® Universal PCR Master Mix and predesigned primer pairs (Thermo Fisher Scientific) for rat Gapdh (Rn01775763_g1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using TaqMan® Universal PCR Master Mix and predesigned primer pairs (Thermo Fisher Scientific) for rat Gapdh (Rn01775763_g1) ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM of primers and Power SYBR™ Green PCR Master Mix (Applied Biosystems) in a BioRad thermocycler ...
-
bioRxiv - Plant Biology 2022Quote: ... Gene-specific PCR primers (Table S3) were used in a reaction with Dreamtaq (Thermofisher). Colonies were picked into 20 μl sterile water with a micropipette tip and resuspended ...