Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The PCR for each sample was set up in triplicate 25 μl reactions employing the DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, USA), with 0.25 μmol L–1 of forward and reverse primer each and 2 μl DNA template ...
-
bioRxiv - Microbiology 2019Quote: ... primers against the V3–V4 hypervariable region of the 16S gene (CCTAYGGGRBGCASCAG forward primer; GGACTACNNGGGTATCTAAT reverse primer).41 PCR was done using AmpliTaq Gold 360 master mix (Life Technologies, Mulgrave, Australia) following a two-stage PCR protocol (29 cycles for the first stage ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of CRK2 was amplified by PCR (forward primer: ATGAAGAAAGAACCTGTCC, reverse primer: TCTACCATAAAAGGAACTTTGTGAG) and inserted into pDONRzeo (Invitrogen; Thermo Fisher Scientific), then transferred to the pBm43GW (Invitrogen ...
-
bioRxiv - Plant Biology 2019Quote: ... The promoter region of CRK2 was amplified by PCR (forward primer: GGTTTTAGATCGTGTTAGATATATCA, reverse primer: TTTGTTTTGTTTGATTGAGAAA) and inserted into pDONR4R1 (Invitrogen; Thermo Fisher Scientific), then transferred to pBm43GW ...
-
bioRxiv - Physiology 2020Quote: All forward and reverse quantitative PCR (qPCR) primers (Table 1) were designed using Primer Express 3.0.1 (Applied Biosystems, ThermoFisher Scientific, Wilmington, DE, USA). Primers were designed using sequences from the brook trout transcriptome from Sutherland et al ...
-
bioRxiv - Microbiology 2022Quote: ... difficile was PCR-amplified (forward primer: ATGTGTAGTGAACAAAAATTTTTTATATGT, reverse primer: CAGTTCAGCCTTCCATAATCCATG) and TA cloned into the expression plasmid pTrcHis2 TOPO (Thermofisher, Carlsbad CA, USA), in-frame with the C-terminal myc-6XHis and Myc tags ...
-
bioRxiv - Plant Biology 2024Quote: ... The cell pellet was overlaid with 143 µL of 70% nitric acid (trace metal grade, A467-500, Fisher Scientific) and incubated at 65°C for 16 h before dilution with 9.5 mL Milli-Q H2O to a final nitric acid concentration of 2% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... About 1.4µg of DNase-treated total RNA was set aside for reverse transcription against (-)RT controls using the high capacity cDNA reverse transcription kit (Thermo Fisher™). Codon optimized RBD gene expression was assessed against a cells only control using qPCR and normalized to human 18S rRNA gene levels by the delta delta Ct method (Livak and Schmittgen ...
-
bioRxiv - Molecular Biology 2023Quote: ... FACS buffer was used to wash the cells followed by fixation for 20 min at RT using Foxp3/Transcription Factor Staining Buffer set (Thermo Fisher Scientific). Surface-stained cells were washed ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR was set up with quadruplicate technical replicates using PowerUP™ SYBR® Green Master Mix (Applied Biosystems, Carlsbad, CA, USA). The template cDNA was diluted 5-fold and used for RT-qPCR using a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... mRNA gene expression was determined using SYBR Green RT-PCR on the cDNA template and PCR was performed using StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, Massachusetts, USA). The mRNA expression of each gene was evaluated using the comparative Ct (ΔΔCT ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative reverse-transcription PCR (q-RT-PCR) was performed on a Step One Plus Real Time PCR System (Applied Biosystems, Foster City, CA, USA) using TaqMan gene expression assays (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and Cg specific primers in a 20 μl PCR reaction using High Fidelity Platinum PCR Supermix (Life Technologies, Carlsbad, CA) and amplified by 40 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: The PCR products were purified to remove unincorporated primers and dNTP’s using the PCR purification kit (Purelink PCR purification kit, Invitrogen, USA). The purified products were processed for sequencing on a next generation sequencer platform @ 40X coverage (MiSeq ...
-
bioRxiv - Genomics 2020Quote: ... PCR were performed with primers ordered from IDT using either Phusion U DNA Polymerase Green MultiPlex PCR Master Mix (ThermoFisher) or Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... real-time quantitative PCR analysis with a gene specific primer pair using SYBR green PCR mix (Applied Biosystems, cat: 4385612) was performed and data was analysed on the Applied Biosystems ViiATM 7 Real-Time PCR System ...
-
bioRxiv - Microbiology 2022Quote: ... These 2 reaction products were then combined in a second PCR reaction with primer pairs 53 + 56 and the resultant DNA cloned into pCR-Blunt (Invitrogen) before being excised using XbaI + EcoRI and cloned into XbaI + EcoRI cut pSGRJFH1luc ...
-
bioRxiv - Genetics 2021Quote: ... the PCR products from either primer pairs 6/7 or 9/10 with the plasmid vector pCR 2.1 (Thermo Fisher) followed by transformation of One Shot Top 10 chemically competent cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... Primer to be used for quantitative reverse transcription-PCR (qRT-PCR) were designed using the Primer Express 3.0 software (Applied Biosystems) and efficiencies were validated prior to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... The kinesin-1 motor domain was PCR amplified from cDNA using gene-specific primers and cloned into the pCR-XL-2-TOPO vector (Invitrogen) as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR (qPCR) was performed using specific primers (0.2µM concentration and SYBR Green PCR Master Mix (Applied Biosystems, #4309155) on the Mastercycler RealPlex2 (Eppendorf) ...
-
bioRxiv - Bioengineering 2023Quote: Total miR levels in extracted RNA samples were quantified using a Qubit miR Assay Kit and Qubit 3.0 Fluorimeter (Thermo Fisher Scientific, Waltham, MA, USA); the manufacturer’s protocols were employed.
-
bioRxiv - Systems Biology 2020Quote: ... The Taqman method was used for real-time PCR with primers from Life technologies. The expression of mRNA was normalized to the geometrical mean of 3 house-keeping genes ...
-
bioRxiv - Cell Biology 2020Quote: ... primers (Table 1) and Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific) were used in standard conditions and relative RNA quantification was normalized to the housekeeping gene GAPDH.
-
bioRxiv - Developmental Biology 2019Quote: ... We performed qRT-PCR with bcd-specific primer pair using SYBR Green (Thermo Fisher) protocol and the housekeeping gene rpl32 was used as internal reference ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cancer Biology 2022Quote: ... real-time PCR for genes was performed using individual gene Taqman primers (Applied Biosystems) with an ABI 7500 real-time PCR system ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with gene specific primers on a 7900HT real-time PCR machine (Applied Biosystems). Statistical significance was determined by Students t test based on triplicated experiments.
-
bioRxiv - Microbiology 2020Quote: ... The backbone of pENTR plasmid was amplified by PCR using primers pENTR_gibson_backbone_F and pENTR_gibson_backbone_R from the pENTR-D-TOPO cloning kit (Invitrogen). The resulting PCR product was subsequently treated with DpnI to remove methylated template DNA ...
-
bioRxiv - Immunology 2022Quote: ... and target specific TaqMan real-time PCR assay primer probes (ThermoFisher Scientific, Waltham, MA). Viral burden was determined by quantitative real-time RT-PCR on lung RNA for viral matrix protein (M1 ...
-
bioRxiv - Genetics 2019Quote: ... PCR-based primer panels were designed with Ion AmpliSeq™ Designer (Thermo Fisher Scientific) to amplify all exons and flanking regions (10 bp ...
-
bioRxiv - Physiology 2020Quote: ... qRT-PCR experiment was performed by Taqman Gene Expression Assay primers (Thermo Fisher Scientific) in triplicates using LightCycler 480 Real-Time PCR System (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2020Quote: ... using TaqMan® Universal PCR Master Mix and predesigned primer pairs (Thermo Fisher Scientific) for rat Gapdh (Rn01775763_g1) ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed using Taqman primers for Csf3 (Thermo Fisher Scientific Mm00438334_m1), Cxcl1 (Mm04207460_m1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using TaqMan® Universal PCR Master Mix and predesigned primer pairs (Thermo Fisher Scientific) for rat Gapdh (Rn01775763_g1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Gene-specific PCR primers (Table S3) were used in a reaction with Dreamtaq (Thermofisher). Colonies were picked into 20 μl sterile water with a micropipette tip and resuspended ...
-
bioRxiv - Developmental Biology 2023Quote: ... gene-specific primers and Power SYBR Green PCR Master Mix (Applied Biosystems, UK, #4309155) with a Bio-Rad C1000Touch™ Thermal Cycler ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM of primers and Power SYBR™ Green PCR Master Mix (Applied Biosystems) in a BioRad thermocycler ...
-
bioRxiv - Immunology 2021Quote: ... followed by specific TaqMan® miR-34a Assay (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Ambion pre-miR miRNA precursor molecules (Thermo Fisher Scientific, UK) were used for transient miR-187 overexpression ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were transfected with hsa-miR-3p mimic (Invitrogen) or a control mimic at 5 nM final concentration using Opti-MEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... or hsa-miR-106b-3p mirVana™ miRNA Mimic (Ambion) at final concentration of 5 nM ...
-
bioRxiv - Neuroscience 2021Quote: ... miRNA mimics (Ambion™ Pre-miR miRNA Precursor, Thermo Fisher), and pLNAs (miRCURY LNA miRNA Power Inhibitors ...
-
bioRxiv - Neuroscience 2022Quote: ... and hsa-miR-132 (Applied Biosystems miRNA assay ID 000457).
-
bioRxiv - Neuroscience 2023Quote: ... or respective quantities of pre-miR negative control duplex (Ambion) at DIV9 ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR reaction was set by using TaqPath 1-Step Master Mix (Cat. No. A28527; Thermo Fisher) with a primers and a FAM-labeled probe targeting the N1 amplicon of N gene (2019-nCoV RUO Kit ...
-
bioRxiv - Microbiology 2019Quote: ... The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies, Carlsbad, CA) in a total volume of 50 µl ...
-
bioRxiv - Microbiology 2022Quote: ... The cycling conditions were set in the PikoReal™ Real-Time PCR System (Thermofisher Scientific, Waltham, MA) as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplification reactions (triplicates) were set up using Power up SYBR Green PCR Master Mix (Thermo Fisher Scientific) and qRT-PCR was validated with the QuantStudio 1 Real Time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... Amplification reactions (triplicates) were set up using the PowerSYBR Green PCR Master Mix (Thermo Fisher Scientific, 4367659) and qRT-PCR was performed using the QuantStudio™ 5 Real-time PCR system (Thermo Fisher Scientific) ...