Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for 6 hydroxy 2 methylquinazolin 4 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were seeded onto 6-well cell culture plates and transiently transfected with 4 μg plasmid using Lipofectamine 2000 transfection reagent (Invitrogen). After 24 h culture ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from HIEs wells (in hW-CMGF+ or differentiation media for 4 days) or MA104 cells grown to confluency in a 6-well plate using TRIzol reagent (Ambion). Total RNA was treated with Turbo DNase I (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of SOSIP trimer or 3.2 μg of SOSIP-I53-50NP (which is equivalent to 2 μg of trimer) were loaded on a 4-12% Tris-Glycine gel or 6-18% Tris-Glycine gel (both from Invitrogen). For BN-PAGE ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... and the supernatant centrifuged twice at 1000g for 10 min at 4°C (Sorvall RC-6 Plus Centrifuge, Thermo Scientific). The supernatant was centrifuged 8000g for 10 min at 4°C and then aspirated without disturbing the pellet ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged once a week (∼80% confluence/well) at 1:4-1:6 ratios using 1mg/ml collagenase (Gibco) to detach colonies and onto fresh ir-MEF plates.
-
bioRxiv - Genomics 2022Quote: ... For each transfection 1.6 ug of plasmid DNA has been incubated for 20 minutes with 4 µl of Lipofectamine 2000 transfection reagent (Invitrogen) in 0.2 ml of OptiMEM media (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Immunology 2023Quote: 5×105 NIKWT and NIKKO BMDMs were stimulated with 20ng/mL IL-4 for 6 hours before being lifted with PBS containing 1mM EDTA (Gibco, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 1 × 106 NIKWT and NIKKO BMDMs were stimulated with 20ng/mL IL-4 or PBS for 6 hours before being lifted with PBS containing 1mM EDTA (Gibco, ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... One mg of total protein/sample were incubated for 6 h at 4°C with protein A/G-magnetic beads (Dynabeads, Invitrogen) prebound with 5 μg of anti-mCherry antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... One mg of total protein/sample were incubated for 6 h at 4°C with protein A/G-magnetic beads (Dynabeads, Invitrogen) prebound with 5 μg of the corresponding antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.2 M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 µg/mL DAPI (4’, 6-diamidino2-phenylindole; Molecular Probes). Cells were imaged with a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Immunology 2019Quote: ... stained with Alexa Fluor™ 488 phalloidin for 3h at a dilution of 1/100 (Thermo Fisher Scientific, A12379) and DAPI at a dilution of 1/80000 for 10min ...
-
bioRxiv - Cell Biology 2021Quote: ... Sample concentration and purity was determined with the NanoDrop One (ThermoFisher, Cat # ND-ONE-W).
-
bioRxiv - Cell Biology 2024Quote: ... The labeling efficiency was calculated using NanoDrop One Spectrophotometer (Thermo Fisher Scientific #ND-ONE-W). The average probe labeling efficiency was ∼90% ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Interleukin-6 (IL-6) (Thermo Fisher Scientific), 20 ng/mL Interleukin-3 (IL-3 ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 2 h at room temperature with one of the species-matching conjugated secondary antibodies (all from ThermoFisher Scientific): goat anti-mouse Alexa-Fluor 555 (cat ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the Express one step RT-qPCR Universal kit (ThermoFisher Scientific) using 3.5µL of RNA and 6.5µL of RT-qPCR mix that contains 250nmol of each primer and 75nmol of probe ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The final pooled library was diluted to an appropriate concentration and then subjected to Ion Sphere Particle (ISP) emulsion PCR amplification using an Ion One Touch 2 and an Ion PI Template OT2 200 Kit (Life Technologies). We sequenced the final library in two runs on an Ion Torrent Personal Genome Machine (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... One half of each tissue sample was homogenised in 1ml DMEM medium containing 2% FBS supplemented with Penicillin/Streptomycin (Gibco, USA) for 5min at 30Hz using a Tissue Lyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS CoV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was run over either one (at 10°C) or two (at 10°C and 2°C) immobilized pepsin columns (Applied Biosystems; Poroszyme Immobilized Pepsin Cartridge ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS COV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... and the SARS-CoV-2 spike gene was reverse-transcribed and amplified with a SuperScript IV One-Step RT-PCR kit (ThermoFisher Scientific) using primers flanking the S gene ...
-
bioRxiv - Plant Biology 2022Quote: ... and 2 mL of 1:10 diluted cDNA in an Applied Biosystems Step One Plus real-time PCR instrument (ThermoFisher, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Cas12a-gRNA ribonucleoprotein complexes containing one sgRNA targeting the vault1-2 gene (TTTAGCTCAGCGGTTACTTCGAGTACA) were nucleofected in HEK293T using Neon Transfection System (Thermo Scientific). After 48 hours cells were single-cell sorted into 96-well plates and subsequently genotyped ...
-
bioRxiv - Biochemistry 2023Quote: ... The temperature was increased from 5 °C to 95 °C over 2 hours and readings taken using a One Step Plus RT-PCR (Applied Biosystems).
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gels were then rinsed one time in deionized water and placed into an iBlot 2 mini transfer stack (Thermo Fisher Scientific). The transfer stack was loaded onto the iBlot 2 Gel Transfer Device (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was co-transcriptionally capped using m7(3’OMeG)(5’)ppp(5’)(2’OMeA)pG capping reagent (Hongene Biotech) in a “one-pot” reaction followed by digestion with DNase I (Thermo Fisher). Linear mRNA was purified using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Pathology 2023Quote: ... which was previously labeled at its 5’ end with one of four specific fluorescent dyes (6-FAM®, NED®, PETTM and VICTM; Thermo Fisher Scientific, Waltham, MA, U.S.A) (Table 2) ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated overnight at 4°C or at room temperature for 4 hrs in one of the following primary antibodies: 1:3000 mouse α-GFP (MA5-15256, Thermo Fisher Scientific), 1:3000 rabbit α-hexokinase (H2035-01 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Secondary antibodies were diluted in blocking solution and incubated with samples for at least one hour and not more than 4 hours as follows: Alexa 488 donkey α-mouse (1:1000, Thermo Fisher Scientific), Alexa 647 goat α-rabbit (1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Neuroscience 2021Quote: ... preparations were washed six times with PBT and incubated for one night at 4°C with secondary antibodies goat anti-rabbit Alexa 488 (Invitrogen, USA; 1:250) and goat anti-mouse DyLight 649 (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were then incubated in secondary antibodies (diluted in 5% serum in PBT at 4°C for 2–4 days): Alexa 488 anti-Chicken IgY (Invitrogen A11039; 1:400); Atto 647N anti-mouse IgG (Rockland 610-156-121 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH=6 (ThermoFisher). Sections were then blocked for 1h at RT with 10% normal donkey serum (Chemicon International Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... or 6% (Thermofisher) tris-glycine SDS-PAGE gels then transferred onto PVDF membranes using the Transblot rapid transfer machine (BioRad) ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Immunology 2020Quote: ... 25mM HEPES (2(−4-(2-hydroxyethyl)-1-piperanzinyl) ethansulfonacid) and supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, ThermoFisher Scientific), 10.000 U/mL (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... on homemade coverslip-bottomed dishes were washed and loaded with Fura 2 by incubation with Fura 2 AM (4 μM, 45 min, 37°C, ThermoFisher, Cat# F1221), washed and imaged at room temperature in HEPES-buffered saline solution (HBSS) ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... the cultures were co-transfected with 2 µg of pCHMP-NS3-Flag and 2 µg of pGag using 4 µL of 293Fectin Reagent (Thermo Fisher Scientific). Cells were pelleted and high-pressure frozen as described in [68] using an HPM100 system (Leica Microsystems) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Interleukin 6 (IL-6) was measured using an IL-6 ELISA kit following manufacturer’s instruction (Invitrogen, Catalog # CHC1263). Similarly ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl cDNA (diluted 1:20) was used in a 6 µl Fast SYBR Green qPCR reaction (ThermoFisher Scientific). No-template controls for each gene were run in all qPCR plates ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 (438-516) S-RBD((HiS)6 and biotynilated human ACE2 have been purchased from Fisher Scientific (respective references 16534204 and 16545164) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated at 1 x 10^6 cells per well of a 6 well plate or 5 x 10^6 cells per T25 flask in stage 2 media consisting of 47.5% IMDM (Gibco), 47.5% F12 (Gibco) ...