Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 4°C for 2 hours with gentle agitation and subsequently with 45 μL Dynabeads Protein G (Thermo Fisher Scientific) at 4°C overnight with gentle agitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The suspension was incubated at 25°C for an additional 2 hr with Protein G SepharoseTM 4 Fast Flow or DynabeadsTM Protein G (Invitrogen), pre-blocked with 1 mg/ml BSA and 0.25 mg/ml Salmon Sperm DNA ...
-
bioRxiv - Immunology 2021Quote: ... Supernatants were subjected to high speed centrifugation at 16,000 x g for 2 hours at 4°C (Sorvall LYNX 6000, Thermo Scientific). The virus pellet was suspended in 0.9% NaCl and sonicated on ice at 20kHz frequency and 70% amplitude for 15 seconds x 3 cycles (FB505 ...
-
bioRxiv - Cell Biology 2021Quote: ... Secondary antibodies were used at 1:200 dilution in PBT for 2 hours at room temperature or at 4 °C overnight (Goat anti-Chicken Alexa 488, ThermoFisher Scientific cat#A11039 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lysates were centrifuged at 17,000 × g for 10 min and supernatant incubated overnight at 4 °C with 2 μg of anti-PTBP1 antibody (monoclonal-ThermoFisher) or anti-FLAG antibody (monoclonal-Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... F-actin staining was performed at 4°C overnight in PBS 1x containing 0,1% TritonX100 2% FCS with Phalloidin AF405plus (Life technologies). Samples were washed in PBS 1x and mounted with Prolong Antifade Gold mounting medium (Life technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 4°C for 2 hours with gentle agitation and subsequently with 45 μL Dynabeads Protein G (Thermo Fisher Scientific) at 4°C overnight with gentle agitation ...
-
bioRxiv - Immunology 2020Quote: ... CAR T cells were incubated for 30 min at 37°C with either 1μM fura-2 AM or fluo-4 AM (Life Technologies). T cells were then washed in HBSS and resuspended in TexMACS complete medium with 3% AB serum ...
-
bioRxiv - Immunology 2021Quote: ... samples were incubated for 30 minutes at 4°C with 2 μl/ml Fixable Viability Dye eFluor506 (Thermo Fisher Scientific) while in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies in 2% BSA/PBS were incubated overnight at 4°C and secondary antibodies (Thermo Fisher Scientific, Alexa Fluor) were incubated for 2 hours at room temperature and washed with PBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... P0-2) animals were removed and placed in 4°C cooled Hank’s Buffered Salt Solution (HBSS; GIBCO Life Technologies, Germany). Hippocampi were carefully dissected out and placed in Neurobasal-A Medium supplemented with B27 ...
-
bioRxiv - Neuroscience 2021Quote: ... P0-2) animals were removed and placed in 4°C cooled Hank’s Buffered Salt Solution (HBSS; GIBCO Life Technologies, Germany). Hippocampi were carefully dissected out and placed in Neurobasal-A Medium supplemented with B27 ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was then incubated overnight at 4°C and under agitation with 2 mL Ni-NTA resin (50% v/v, Thermofisher) pre-equilibrated with lysis buffer.
-
bioRxiv - Molecular Biology 2021Quote: ... 10’000 rcf for 30 min and then ultracentrifuged at 120’000 rcf at 4 °C for 2 h (TH 64.1 rotor, Thermo Fisher Scientific). The epididymosomal pellet was then washed in PBS at 4 °C and ultracentrifuged at 120’000 rcf at 4 °C for 2 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... PABP-GFP-mRNA complexes were immunoprecipitated from cleared lysates for 2 hours at 4°C using Dynabeads protein G (ThermoFisher) conjugated to anti-GFP (clones 19F7 and 19C8 ...
-
bioRxiv - Biochemistry 2022Quote: ... The cleared lysates were incubated for 2 h at 4°C with IgG-coupled Dynabeads (Dynabeads M-270 Epoxy; Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting pellets were resuspended in 2 mls PBS and dialyzed overnight at 4°C in 1L PBS using SnakeSkin 10,000 MWCO dialysis tubing (Thermo Fisher). Buffer was refreshed and samples were dialyzed again overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... MBL) and an additional 2 h at 4°C with 20 μL of a slurry of IgG-conjugated Dynabeads (Invitrogen). After washing the beads five times with IP buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and grown to an OD600 range of 2-4 at 30°C in a deep-well 96-well plate (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... endogenous PABP-mRNA complexes were immunoprecipitated from cleared lysates for 2 hours at 4°C using Dynabeads protein G (ThermoFisher) conjugated to anti-PABP (clone 10E10 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gradient was centrifuged at 200.000×g for 2 hours at 4°C in a S52-ST rotor (Thermo Scientific) and subsequently fractionated into 14 fractions using the BioComp Piston Gradient Fractionator device ...
-
bioRxiv - Cell Biology 2023Quote: Binucleation analyses and detection of aberrant divisions were performed by heat-fixing cells on a microscope slide at 70 °C before staining with 4’,6-diamidino-2-phenylindole (DAPI) (SlowFade Diamond Antifade Mountant with DAPI, Invitrogen) and Calcofluor (Sigma) ...
-
bioRxiv - Bioengineering 2023Quote: ... TUBB4A and MUC5AC overnight at 4 °C and then incubated with Alexa 488-F(ab’)2 fragment of goat anti-mouse IgG (Invitrogen) for 2 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... intracellular staining was performed for 2 h at 4°C after stimulation for 2 h with PMA/Ionomycin Cell Stimulation Cocktail containing protein transport inhibitors (ThermoFisher). Data were acquired on an Aurora (Cytek Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody–protein complexes were recovered during 2 h incubation at 4°C with protein A/G magnetic beads (Thermo Scientific), followed by duplicate washes of 15 min with low-salt wash buffer (0.1% SDS ...
-
bioRxiv - Immunology 2024Quote: ... filtered through a 0.45 µm pore-sized filter to remove cell debris and concentrated by centrifugation at 100000 g for 2 h at 4°C (Thermofisher WX Ultra80 centrifuge ...
-
bioRxiv - Microbiology 2024Quote: ... The protein denaturation was monitored by obtaining the fluorescence signal by increasing the temperature from 22 °C-95 °C at 0.5 °C/minute rate using QuantStudio 3 real-time PCR (ThermoFisher). The melting temperature (Tm ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... Cells were then incubated with primary antibodies (overnight, 4°C), washed (5X, PBS, 4°C) and incubated with species-specific secondary antibodies coupled to fluorophores (Thermo Fisher). Cells were then washed (5X ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracts were clarified by centrifugation twice for 15 minutes at 16,000 rcf at 4°C and 100 μl embryo extract was rotated at 4°C overnight with 30 μl magnetic ProteinA dynabeads (Life Technologies) coupled with anti-MBP antibodies (gift from Jordan Raff ...
-
bioRxiv - Biophysics 2019Quote: ... hNSPCs were passaged approximately every 5-7 days using Cell Dissociation Buffer (Invitrogen) and split 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Cancer Biology 2024Quote: HepG2 and HuH-7 cells were maintained in 5 mM Glucose DMEM (Gibco) supplemented with 10% fetal bovine serum and antibiotic supplements (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-rat CD73 (Fisher Scientific, BDB551123, 5 μl per 10^7 cells) and mouse IgG microbeads (Miltenyi Biotech ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Plant Biology 2020Quote: ... 15N-labeled seedlings were then dried for 2-3 days at 65°C and further analyzed by Thermo Finnigan Delta plus XP IRMS (ThermoFisher Scientific). For primary root length determination ...
-
bioRxiv - Genomics 2020Quote: ... 4 × 10−5 % biotin (Life Technologies #B1595), 13.4 g/ l (1.34% (w/v) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 min incubation (at 37 °C) of Hoechst dye (Life Technologies; 1:15,000 dilution) in warm PBS ...
-
bioRxiv - Microbiology 2019Quote: ... and cultured (37 °C, 5% CO2) on Petri dishes containing DMEM with 1% HEPES (Gibco), 10% FBS and 20% L cell-conditioned medium (LCM ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the samples were incubated at 56 °C for 1 hour with 5 mM dithiothreitol (ThermoFisher). Then ...
-
bioRxiv - Immunology 2021Quote: ... Prepare for biotin pull-down by washing 5 μl of Streptavidin C-1 (Invitrogen, 65001) beads with Tween Wash Buffer (5 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2024Quote: ... and incubated for 5 minutes at 37°C with 1 mL room temperature Accutase (Gibco) to detach the cells from the plate ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 mM PMSF) and precleared for 1 hour at 4°C with 25 μl of protein G Dynabeads (Invitrogen). The precleared chromatin solution (1.5 × 106 cells ...