Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Neuroscience 2024Quote: ... with 2% heat-inactivated FBS Certified One Shot (Gibco, A38400-01) and 1x N-2 supplement (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... No mycoplasma were detected in cultures by 4′,6-diamidino-2-phenylindole (DAPI) or TO-PRO-3 (Thermo Fisher Scientific) staining ...
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were probed with the following primary antibodies at 4°C overnight: mouse anti-EphA4 C-terminus (Invitrogen, USA; 1:1000), goat anti-EphA4 N-terminus (R&D Systems ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were incubated at 4°C overnight and then blocked for 1 hour at 37°C using SuperBlock (ThermoFisher Scientific, Cat. # 37516), and then washed four times with PBS 0.05% Tween-20 (PBST) ...
-
bioRxiv - Cancer Biology 2024Quote: ... an additional 150 µL of a 1:1 mixture of NK-Xpander complete medium:OncoPro complete medium containing 500 U/mL rhIL-2 and 10 µM Invitrogen™ CellEvent™ Caspase-3/7 Red Detection Reagent (Thermo Fisher Scientific, cat# C10430) was added to each well ...
-
bioRxiv - Genomics 2021Quote: ... Samples were transferred to 1.5 mL safe-lock tubes containing one scoop of acid-washed glass beads (<106μM) and 1 mL TRIzol (Invitrogen) containing 20μg/mL GenElute-LPA (Sigma-Aldricht ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by laminin (Thermo Fisher 23017015, 1-2hr at 37°C, 2 μL/well) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... we re-suspended cells in PBS/ 0.2% human serum containing 2 µg/mL 7-aminoactinomycin D (7-AAD) (Invitrogen, Cat# A1310). We carried out isotopic controls with irrelevant mouse IgG1-APC ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Cell Biology 2022Quote: ... seeded on t25 flasks at 37°C 5% CO2 in DMEM/F12 (1:1) (ThermoFisher Scientific, Cramlington, UK) with 10%FBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... One-third to one embryo equivalents were loaded at per lane on 4%-12% or 8% Bolt® Bis-Tris (Invitrogen). GFP Rabbit IgG Polyclonal Antibody (Molecular Probes ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNAs from 7-d-old seedlings grown on 1/2 MS with or without 1 μM ABA were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) or Universal Plant Total RNA Extraction Kits (Spin-column)-I (BioTeke ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...