Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Immunology 2021Quote: ... 1:100 human IgG (1 mg/ml) as FcR block and 2 % FCS using the following staining reagents: 7-AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated with mouse mAb SARS-CoV-2 nucleocapsid antibody (SinoBiological, 1:100) and rabbit Claudin 7 polyclonal antibody (ThermoFisher, 1:200) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The iPSCs were then cultured for 7 days in Neurobasal/DMEM-F12 medium (1:1 v/v) containing 2% B27 (Gibco, 17054–044), 1% N2 (Gibco ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3’-linked footprints were denatured at 80°C for 2 min and purified on 10% TBE-Urea polyacrylamide gels (Invitrogen) in 1x TBE (Ambion ...
-
bioRxiv - Physiology 2024Quote: Mouse DRG neuron cultures were loaded for 30 min at 37 °C with 3 µM Fura-2 AM (Invitrogen F1221) in ES containing also 0.02% Pluronic F-127 and left to recover for about 10 min in ES before recording ...
-
bioRxiv - Molecular Biology 2024Quote: The transfection of a mixture of specific siRNA against c-Myc protein (exon 2 and exon 3, IDs s9129 and s9130, respectively; Ambion) and DOT1L protein (IDs s39011 ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... were incubated at 37°C for 2 h and analyzed by SDS-PAGE on a 3-8% tris-acete NuPAGE gel (Invitrogen) and stained with Pierce Silver Stain Kit (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... cell vials were thawed 2-3 min in a 37°C water bath and transferred in T25 cell culture flasks (Gibco) with 5ml of hASC culture medium containing Minimum Essential Mediun (αMEM ...
-
bioRxiv - Molecular Biology 2019Quote: ... Antibody-bound chromatin was captured with magnetic beads for 1 h at 4°C (50 μl 1:1 mixture of Dynabeads Protein A and Dynabeads Protein G, Invitrogen). DNA from both input and ChIP samples was then extracted using phenol/chloroform ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Molecular Biology 2022Quote: ... We ligated both with an insert:vector ratio of 1:4 using Ligase (Thermo Scientific; 1 h, 22 C). The ligation mix was purified (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies were incubated at 4°C overnight (Abcam, ab138501, 1:1,000; Thermo Fisher Scientific, AM4302, 1:5,000). Horseradish peroxidase-conjugated secondary antibodies were incubated for 1 hr at room temperature (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies] ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Biochemistry 2019Quote: ... 7-hydroxy-4-cyanocoumarin (CHC) and BODIPY 577/618 maleimide were from Invitrogen/Molecular Probes Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and CellTracker Blue CMAC (7-amino-4-chloromethylcoumarin) dye (Life Technologies, Carlsbad, CA) as a vacuole lumen marker ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cell Biology 2020Quote: Whole protein extracts were prepared from JJN3 pellets (4°C, 150 x g, 5 min) according to the cell extraction protocol for ELISA sample preparation by ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... produced from DKO piglet were prepared and stained at 4°C for 45 minutes with Alexa 488-conjugated Griffonia simplicfolia isolectin IB4 (GS-IB4) (5 μg/mL, Invitrogen). The stained cells were washed twice and then analyzed by flow cytometer (BD Accuri™ C6 Plus) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were boiled at 95°C for 5 min before running on a NuPAGE 4-12% Bis-Tris protein gradient mini gel (Invitrogen) at 200 V for 5 min in MOPS running buffer (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: Neuronal suspensions were labelled at 37°C with a combination of the Fluo-4 calcium indicator (5 μg/ml; Invitrogen) and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were heated to 50°C for 5 minutes before being loaded on 4-12% Novex WedgeWell Tris-Glycine gels (ThermoFisher).
-
bioRxiv - Bioengineering 2021Quote: ... 10 µg of each sample was boiled at 95°C for 5 min and loaded onto the 4-12% Bis-Tris Gel (NP0336, ThermoFisher). Gels were run for 1 hour and 15 min at 120 V in with NuPage MES Buffer (NP0002 ...
-
bioRxiv - Biochemistry 2021Quote: ... and samples were incubated at 70°C for 5 minutes and loaded onto Bis-Tris 4-12 % gradient gels (ThermoFisher). Bands were stained by CBB and relative band intensity was quantified by scanning and semi-automated analysis in ImageQuant (GE Healthcare).
-
bioRxiv - Systems Biology 2021Quote: ... and samples were centrifuged at 16,000g for 5 minutes at −4°C in a Sorvall Legend Micro 17R microcentrifuge (Thermo Scientific). The supernatant (extract ...
-
bioRxiv - Pathology 2022Quote: ... for 5 min at 95 °C before they were loaded in Bolt™ 4–12 % Bis-Tris gels (Thermo Fisher). After separation ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were boiled at 95°C for 5 min and loaded on SDS-PAGE (NuPAGE 4-12% Bis-Tris, Invitrogen). Efficiency of ligand coupling to the Ad capsid (% total hexon protein coupled ...
-
bioRxiv - Cell Biology 2020Quote: ... proteins were transferred onto a nitrocellulose membrane and then blocked overnight while shaken at 4 °C in TBST-5% BSA—a TBS Tween-20 (TBST; ThermoFisher) solution containing 5% bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2022Quote: Hemolymph sporozoites collected on days 19 to 24 post-infection were centrifuged for 5 min at 450 x g and 4 °C in an 8-well Lab-Tek chamber slide (Nunc) or a 384-well plate (Greiner) ...
-
bioRxiv - Microbiology 2021Quote: ... boiled at 100°C for 5 min and then separated on NuPAGE Novex 4-12% Bis-Tris midi gels (Invitrogen) using NuPAGE MES SDS Running buffer (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% DTT) for 10 min at 70 °C before being loaded on a 4-12% Bis-tris gel (ThermoFisher NP0322BOX) at 10 µg/lane ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50-100 μg of total protein extracts were solubilized in SDS-sample buffer by boiling at 95°C for 5 minutes and analysed by SDS polyacrylamide gel electrophoresis (4-12% NuPAGE gel; Invitrogen). Western blotting was performed using antibodies against Vasa (rat ...
-
bioRxiv - Bioengineering 2019Quote: ... proteins were transferred onto a nitrocellulose membrane and then blocked overnight while shaken at 4°C in TBST-5% BSA – a TBS Tween-20 (TBST; ThermoFisher) solution containing 5% bovine serum albumin (BSA ...