Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for Dengue Virus Serotype 2 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations of EPs and cell lysates were determined using Pierce™ BCA Protein Assay Kit (Thermo Scientific). Protein lysates were separated using Bolt™ 4-12% Bis-Tris Plus Gels (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... The cell pellet was subjected to nuclear protein extraction using the NE-PER Protein Extraction Kit (ThermoFisher 78833) with the addition of Protease Inhibitor Cocktail (Thermo Scientific 781410 ...
-
bioRxiv - Cell Biology 2021Quote: ... Total protein in cell lysates was quantified using the bicinchoninic acid (BCA) protein assay (ThermoFisher, #23221 and #23224) and normalized to 1.5 mg/ml of protein for each sample ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... Total protein concentration was determined for cell lysates with the Pierce BCA protein assay kit (Thermo Fisher Scientific), utilizing 50 μg of cell lysate for each sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total concentration of proteins in cell lysates was measured by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the recommendations from the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: Total proteins were harvested from tissue and cell lines lysates using M-PER protein extraction reagent (Thermo Fisher) respectively supplemented with proteinase and phosphatase inhibitors (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: Total proteins were harvested from tissue and cell lines lysates using M-PER protein extraction reagent (Thermo Fisher) and supplemented with proteinase and phosphatase inhibitors (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... Whole cell protein extracts were obtained as described above and protein concentrations determined using Bradford reagent (Thermo Scientific). 2.5 μg of total protein were loaded on 12% Mini-Protean TGX pre-cast gels (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... total protein concentrations of the cell extracts were quantified using the QubitTM Protein Assay Kit 3.0 Fluorometer (ThermoFisher). 2 μg of total protein extracts from each P ...
-
bioRxiv - Cell Biology 2023Quote: Total protein concentrations were measured in cell lysates using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). A total of 15 µg of total protein fraction for each sample was separated by electrophoresis using NuPAGE™ 4-12% Bis-Tris Protein Gel (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... proteins were transferred to polyvinylidene difluoride membranes using the iBlot 2 dry blotting system (Thermo Fisher) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were transferred onto nitrocellulose membranes using an iBlot 2 Dry Blotting System (Invitrogen, Waltham, MA) set to 20V ...
-
bioRxiv - Genetics 2019Quote: ... proteins were transferred to a nitrocellulose membrane using the iBlot 2 transfer apparatus (Thermo Fisher Scientific). A 5% milk solution in 1X TBST was used for blocking for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: Both Nefmut/SARS-CoV-2-based fusion proteins were cloned into the pVAX1 plasmid (Thermo Fisher) as already described (22) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 µl of the studied protein sample was loaded onto a zeroed NanoDrop spectrophotometer (Thermo Scientific). The absorption spectra were recorded in the range of 220-350 nm.
-
bioRxiv - Biophysics 2021Quote: ... Protein was then transferred to a PVDF membrane using iBlot™ 2 Transfer Stacks (Invitrogen IB24002) in iBlot 2 dry blotting device (Invitrogen IB21001) ...
-
bioRxiv - Microbiology 2020Quote: ... anti-NeuN and anti-SARS-CoV-2 spike protein antibodies (Thermo Fisher Scientific, Norcross, GA, USA) overnight at 4°C followed by incubation with Alexa Fluor 546- or Alexa Fluor 488-conjugated secondary antibody for 1 hr at room temperature [31,34] ...
-
bioRxiv - Molecular Biology 2020Quote: Artificial codon optimized genes encoding SARS-CoV-2 nsp10 and nsp16 proteins were commercially synthesized (Invitrogen) and cloned in a pSUMO vector that encodes an N-terminal His8x-SUMO tag ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were transferred from the gel using the iBlot® 2 transfer stacks (Life Technologies, U.S.A) using the iBlot® Gel Transfer Device (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were transferred onto a PVDF membrane using the iBlot™ 2 Transfer System (IB24001, Invitrogen). Membranes were blocked with 3% milk/TBST (T8793 ...
-
bioRxiv - Immunology 2022Quote: ... followed by a 2 h treatment in T-PER™ Tissue Protein Extraction Reagent (Thermo Scientific) at 4°C ...
-
bioRxiv - Neuroscience 2019Quote: ... each protein pellet was digested with 2 µg sequencing grade trypsin (Thermo Scientific, Rockford, IL, USA) overnight at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of the purified BCL-2 family proteins was determined by BCA assay (ThermoFisher Scientific), and they were flash-frozen in liquid nitrogen and stored at -80⍛C.
-
bioRxiv - Biochemistry 2021Quote: Protein gels were either dry transferred onto nitrocellulose membranes using the iBlot™ 2 device (Invitrogen) or wet transferred onto PVDF membrane using the Mini Trans-Blot™ Cell (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Biotinylated SARS-CoV-2 S1 and RBD proteins were combined with fluorescent NeutrAvidin beads (Life Technologies) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... proteins were blotted using an iBlot 2 Dry Blotting System (Thermo Fisher Scientific, Inc., Erlangen, Germany) to a polyvinylidene difluoride membrane (GE Healthcare Europe GmbH ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were transferred to PVDF membranes using an iBlot 2 dry blotting system (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 4°C and incubated with 40ul washed Dynabeads Protein G (Invitrogen 10003D) for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... Protein concentration for lysates was adjusted to 2 μg/μl before adding 4X loading buffer (ThermoFisher), heating to 95 °C for 10 min and running on an SDS-PAGE gel ...
-
bioRxiv - Bioengineering 2022Quote: ... Separated proteins were transferred onto polyvinylidene difluoride (PVDF) membranes using an iBlot 2 (Thermo Fisher Scientific) semi-dry transfer system ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Proteins in the gels were transferred to PVDF membranes using the iBlot 2 transfer device (Invitrogen) and corresponding protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and proteins were transferred to PVDF membranes using the iBlot 2 transfer system (Thermo Fisher Scientific). Membranes were incubated for 1 hr in Rockland blocking buffer (Rockland ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G magnetic beads were incubated with 2 μg anti-p-JAK2 (44-426G, Invitrogen), anti-IRE (NB100-2324 ...
-
bioRxiv - Systems Biology 2023Quote: ... Separated proteins were transferred onto an iBlot™ 2 Transfer Stacks PVFD membrane (Invitrogen™ IB24002) using dry transfer (as described previously [53] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and captured proteins were eluted by boiling beads in 2× NuPAGE LDS Sample Buffer (Life Technologies) containing 100 mM DTT for 45 minutes at 95°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The electrophoresed proteins were transferred to PVDF membranes using iBlot-2 dry blotting system (Thermo Fisher). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatants were first precleared for 2 h at 4°C using Protein G Dynabeads (Invitrogen). Precleared samples were immunoprecipitated with anti-H3K9me3 (abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein was then transferred to PVDF membranes using the iBlot 2 Dry Blotting System from Invitrogen. The membrane was then used for western blot detection in one of two ways.
-
bioRxiv - Immunology 2023Quote: Recombinant Omicron RBD proteins from variants BA.2 and BA.4.5 were obtained from Fisher Scientific. To determine the specificity of mAbs ...
-
bioRxiv - Immunology 2023Quote: ... added to 2 μL of TruCut Cas9 Protein v2 (5 ng/μL, Thermo Fisher Scientific A36498), and incubated for 10 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Proteins were transferred from the gel to the membrane using iBlot 2 Transfer Stacks (Thermo Scientific). The membrane was blocked with Intercept blocking buffer (LI-COR Biosciences ...
-
bioRxiv - Microbiology 2024Quote: ... and surface proteins were biotinylated with 0.5 mg/mL sulfosuccinimidyl-2-(biotinamido) ethyl-1,3-dithiopropionate (ThermoFisher) on ice for 45 minutes with gentle shaking ...
-
bioRxiv - Pathology 2021Quote: All plants and insects were subjected to quantitative PCR analysis for verification of CLas infection using the TaqMan qPCR Master Mix Kit (Ambion®) following Li et al ...
-
bioRxiv - Evolutionary Biology 2021Quote: The ephippia were then opened under a binocular with insect needles and tweezers previously treated under a clean bench (UV sterilization) and with DNase away (Thermo Fisher). Eggs that were already damaged ...
-
bioRxiv - Molecular Biology 2022Quote: ... using sterile surgical blade (Size: 11) by immobilizing the insect on ice and collected antennae into 1.5mL Eppendorf tube containing RNAlater® solution (Thermofisher, USA). Fifty pairs of weevil antennae were used per replicate ...
-
bioRxiv - Microbiology 2023Quote: ... All experiments in this study were carried out in lysogeny broth (LB) and Grace’s insect medium (GIM) (Gibco, GIM 1X, supplemented). GIM is a very nutrient-rich medium and consists of 19 different amino acids ...
-
bioRxiv - Biochemistry 2023Quote: ... The insect hemocoel was filled with 50 μM of the oxidant-sensitive fluorophore dihydroethidium (hydroethidine; DHE; Invitrogen, Carlsbad, CA, United States) diluted in Leibovitz-15 medium containing 5% fetal bovine serum or with DHE and 5 µM MitoTEMPO (Santa Cruz ...
-
bioRxiv - Genomics 2023Quote: ... the frozen insect sample was placed in a 1.5 mL DNase-free disposable grinding tube (Thermo Fisher Scientific, Waltham, MA, USA) with 300 µl of Lysis Buffer T1 (Macherey-Nagel ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... - PCR was performed on each insects genomic DNA using LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGT-GACCAAAAAATCA) primers with the AccuPrime™ Taq DNA Polymerase System (Invitrogen) with 30 or 34 PCR-cycles depending on the templates.
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were fractionated with the Subcellular Protein Fractionation kit for Cultured Cells (ThermoFisher #78840) according to the manufacturer’s recommendations.