Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 2701 citations for 7 METHYL CAMPTOTHECIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and samples were run in the ViiA 7 Real-Time PCR System (Applied Biosystems). The primers used are listed in Table 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were sequenced in 3730 DNA Analyzer with POP-7 Polymer (384) (Applied Biosystems) Primers for sequencing were synthesized at Integrated DNA Technologies (IDT ...
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Design and Analysis QuantStudio 6/7 Pro Systems Software (Thermo Fisher Scientific, Version 2.5.0) was used to identify amplification of genes and calculate fold change from Cq values ...
-
bioRxiv - Cell Biology 2021Quote: Huh-7 cells were plated into 96-Well optical-bottom plates (Thermo Scientific, 1256670) at the density of 5,000 cells/well in conditions similar to other studies ...
-
bioRxiv - Plant Biology 2021Quote: ... 7 μg total RNA was used for rRNA depletion with RiboMinus (Invitrogen, A10838-08) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... MCF-7 and HEK293 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco). Culture media were supplemented with 10% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2020Quote: ... The experiment was performed on QuantStudio 7 Flex real-time PCR systems (Thermo Fisher).
-
bioRxiv - Biophysics 2020Quote: ... pH 7) and incubated with 1:1.5 molar ratio of AF488 (C5 maleimide, Invitrogen) for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... in the QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA). The primer sequences used in this study are listed in Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fluorescence reading of the Taqman assays was performed using QuantStudio 7 Flex (Applied Biosystems). Results were analyzed using the comparative threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2020Quote: ... Fluorescence reading of the Taqman assays was performed using QuantStudio 7 Flex (Applied Biosystems).
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 7 μL of Power SYBR PCR Green Master Mix (Thermo Fisher Scientific, Waltham, MA), 5 pmol of each primer to a final volume of 14 μL ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was measured using a QuantStudio 7 Flex Real-time PCR machine (Applied Biosystems) with Power SYBR green PCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... The qPCR was performed on the Thermo Fisher QuantStudio 7 (Thermo Fisher, Waltham, MA). All reactions were run in triplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Bioengineering 2022Quote: COS-7 cells (ATCC, CRL-1651) were cultured in high-glucose DMEM (Gibco, 21063029) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2019Quote: ... following the manufacturer’s protocol and run on a master cycler (ViiA 7, Thermo Fisher). PCR conditions were 95°C for 30 sec ...
-
bioRxiv - Immunology 2019Quote: ... qPCR assays were run on a ViiA 7 Real-Time PCR System (Applied Biosystems) with the following protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transiently transfected at DIV 7-10 using Lipofectamine 2000 (Invitrogen Cat# 11668019) for 1.5 hours as previously described (Lim et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were allowed to grow for 7 days and then quantified using CyQUANT (Invitrogen) according to manufacturer’s directions ...
-
bioRxiv - Biophysics 2020Quote: ... Unreacted biotin was removed with Zeba Spin Desalting Columns (7 MWCO, Thermo Fisher Scientific). Biotin-labeled proteins were immobilized on the streptavidin (SA ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR analysis of gene expression was performed on the ViiA 7 system (Applied Biosystems) with the Applied Biosystems TaqMan Advanced Master Mix (Applied Biosystems #4444963) ...
-
bioRxiv - Genomics 2020Quote: ... All qPCRs were thermocycled on a ViiA 7 Real-Time PCR System (Applied Biosystems) as follows ...
-
bioRxiv - Physiology 2021Quote: ... Huh-7 cell line was maintained in Dulbecco’s modified Eagle medium (DMEM, ThermoFisher Scientific), supplemented with 10 % FBS and 1 % Penicillin-Streptomycin at 37 °C in 5 % CO2 ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were cryosectioned at 7 μm and collected onto polylysine coated slides (Thermo Fisher). After microCT analysis ...
-
bioRxiv - Immunology 2019Quote: ... coli (5×108 CFU/mL) (7 μg/mL, BacLight, Molecular Probes, Eugene, OR, USA). Fluorescence was assessed after 60 min (37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... and the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies Corporation, USA). Primers specific for the examined HSP-encoding genes (Table S1 ...
-
bioRxiv - Genomics 2021Quote: ... After adding the RT mix (7 µl H2O, 4 µl 5x RT buffer [Invitrogen] ...
-
bioRxiv - Cell Biology 2021Quote: ... The adherent cells were collected on day 7 using TrypLE select enzyme (Fisher Scientific) with 0.3% pluronic acid ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and carried out on an Applied Biosystems Vii 7 RT-PCR system (Life Technologies). Validated gene-specific primers can be found in Extended Data Table 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by qPCR amplification (Viia 7 Real-time PCR System, ThermoFisher Scientific, Waltham, MA) targeting the mitochondrial DNA marker rrnL ...
-
bioRxiv - Developmental Biology 2021Quote: ... Triplicate SYBR qRT-PCR assays were performed on the QuantStudio 7 machine (Applied Biosystems), and relative level of expression was calculated after normalisation to Tbp ...
-
bioRxiv - Cell Biology 2019Quote: ... the carboxylated analog of the cell-permeant agent 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Thermofisher) was used ...
-
bioRxiv - Immunology 2020Quote: LLC-MK2 cells (ATCC CCL-7) were maintained in Opti-MEM (Thermo Fisher Scientific) supplemented with 2% fetal bovine serum and grown in 225-cm2 flask at 37 °C in a CO2 incubator ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed on a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher). Comparative CT analysis (ΔΔCT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 2’,7’-dichlorodihydrofluorescein diacetate (DCF-DA) (10µM; Invitrogen, Carlsbad CA) 4 hours before harvest ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dead cells were excluded either via 7-aminoactinomycin D staining 1:1000 (7AAD, Invitrogen) or Sytox AAD (1:5000 ...
-
bioRxiv - Bioengineering 2021Quote: ... The reaction was run in an Applied Biosystems QuantStudio 7 Flex System (Thermo Scientific) using the following condition ...
-
bioRxiv - Biophysics 2020Quote: COS-7 cells (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO/BRL) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-qPCR was performed in the ViiA 7 Real-Time PCR system (Applied Biosystems), using PowerUp SYBR Green Master Mix (A25918 ...
-
bioRxiv - Immunology 2020Quote: ... MCF-7 cells were labeled with the fluorescent lipophilic dye CM-Dil (Molecular Probes) according to the manufacturer's instructions with minor modifications ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR were performed in a ViiA 7 Real-Time PCR System (Applied Biosystems) with the QuantStudio Real Time Software v1.3 ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM EDTA and 1 µl of 7-AAD (Thermo Fisher, Waltham, MA, USA). 7-AAD-positive cells were quantitated by flow cytometry and analyzed with FloJo software (FloJo LLC. ...
-
bioRxiv - Genetics 2020Quote: ... and run in a QuantStudio 7 Flex Real-Time system (Applied Biosystems, catalogue 448598). Primer sequences to determine KD levels of TRAFD1 were 5’ GCTGTTAAAGAAGCATGAGGAGAC and 3’ TTGCCACATAGTTCCGTCCG ...
-
bioRxiv - Immunology 2022Quote: ... BMDMs were recovered at day 7 by scraping in PBS-EDTA 10 mM (Gibco) and centrifuged before counting and plating ...
-
bioRxiv - Developmental Biology 2022Quote: 7-day adipogenic induced cell populations were lifted with StemPro Accutase (Cat# A1110501, ThermoFisher). Lifted cells were pelleted and resuspended in 1.010 g/mL Percoll solution and loaded onto the top of the prepared Percoll Gradient ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed in a ViiA 7 Real-Time PCR machine (Thermo Fisher Scientific) using TaqMan Universal PCR Master Mix and probes (Thermo Fisher Scientific ...