Labshake search
Citations for Thermo Fisher :
951 - 1000 of 2701 citations for 7 METHYL CAMPTOTHECIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and analyzed on Quantstudio 7 Flex Real-Time PCR system (Thermo Fisher 4485701), following manufacturer’s instructions with UNG incubation hold at 50 °C for 2 min ➔ Polymerase activation Hold at 95 °C for 2 min ➔ PCR (40 cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... we transfected GFP-KDEL to COS-7 cells with Lipofectamine 3000 (Invitrogen, L3000) transfection reagent ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific). Images were captured automatically every two hours for 48 hours using the IncuCyte™ S3 Live-Cell Analysis Instrument (Essen BioScience) ...
-
bioRxiv - Cell Biology 2023Quote: COS-7 cells (ATCC CRL-1651) were cultured in DMEM medium (ThermoFisher #61965026), supplemented with fetal bovine serum (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... qPCR was carried out on Viia 7 Real-Time PCR System (Applied Biosystems) using SsoAdvanced Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were processed using the ViiA 7 Real-Time PCR system (Applied Biosystems). Cxcl9 expression was calculated by the division of Cxcl9 quantity mean expression with quantity mean expression of reference gene Gapdh ...
-
bioRxiv - Genomics 2023Quote: ... following the standard curve method on a QuantStudio 7 Flex machine (Thermo Fisher). A “minus RT” control was used to confirm removal of genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 µM Caspase-3/7 Green detection reagent (C10423, Invitrogen) along with the specified compounds ...
-
bioRxiv - Biochemistry 2023Quote: MCF-7 breast cancer cells (ATCC HTB-22) were grown in MEM (Gibco) supplemented with 10% fetal bovine serum (VWR) ...
-
bioRxiv - Neuroscience 2023Quote: ... and dry organoids were embedded in 7 µl of cold GeltrexTM (Thermo Fisher). GeltrexTM was left to solidify as hanging drops on the inverted cell culture dish for 10 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were resuspended in 7 ml of Waymouth’s medium (Gibco, San Diego, CA) containing 2.5 % FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Plant Biology 2023Quote: ... and 7 μL ddH2O using the ABI Step One (Thermo Fisher Scientific, USA) with two technical replicates ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
The effect of single mutations in Zika virus envelope on escape from broadly neutralizing antibodiesbioRxiv - Microbiology 2023Quote: ... supplemented with 7% fetal bovine serum (FBS) (Gibco BRI; Life Technologies, Gaithersburg, MD) and 100 U/mL penicillin-streptomycin (Gibco BRI ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio™ 7 Flex Real-Time PCR System platform (ThermoFisher Scientific). All experiments were carried out in triplicate technical repeats for three biological replicates ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were cultured for 7 days on bacterial grade plates (Thermo Scientific, 101R20) at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Quantitative real time PCR was run on Applied Biosystems QuantStudio 7 Flex (ThermoFisher) using ∼200 ng RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were grown for 7 days in RPMI 1640 (Thermo Fisher Scientific #11875093) supplemented with 10% FBS (Thermo Fisher Scientific #10270-106) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Neurons were cultured for 7-10 days in complete Neurobasal Plus Medium (Gibco). Mixed glial cells were cultured with the same cortical cell isolation procedure ...
-
bioRxiv - Physiology 2024Quote: ... and quantified by the ViiA 7 Real-Time PCR System (Applied Biosystems, USA). The amount of FoxO1 and FoxO3 mRNA expression was normalized with endogenous control TFRH ...
-
bioRxiv - Immunology 2023Quote: ... cells were washed and stained with 7-Aminoactinomycin D (7AAD) (Invitrogen, 1:400) that was used as dead cell marker ...
-
bioRxiv - Cell Biology 2023Quote: ... Cryosections was prepared at 7 µm with a cryostat (Cryostar NX70, Thermo Scientific.), except at 20 µm for imaging cilia components ...
-
bioRxiv - Developmental Biology 2023Quote: ... Proteins were transferred using the iBlot® 7-Minute Blotting System (Invitrogen, USA) and blocked with 5% non-fat dry milk for 1h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... was performed and analyzed in a ViiATM 7 machine and software (Life technologies). All oligonucleotides are listed in Table S6.
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR and qPCR were then performed on a QuantStudio 7 Flex (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... were then subjected to qPCR using the Applied Biosystems ViiA 7 (ThermoFisher Scientific) for 40 cycles using the following thermocycling parameters ...
-
bioRxiv - Neuroscience 2024Quote: ... and 7 μL SYBR Green qPCR master mix (Thermo Fisher, cat no 4472908). The following primers were used ...
-
bioRxiv - Neuroscience 2024Quote: ... qPCR was performed in a ViiA 7 Real-time PCR system (Applied Biosystems) with ChamQ SYBR® Color qPCR Master Mix Low ROX Premixed (Vazyme).
-
bioRxiv - Plant Biology 2024Quote: ... 62.5 μL of BD 7-AAD Staining Solution (Fisher Scientific, catalog number: BDB559925) was added and mixed ...
-
bioRxiv - Neuroscience 2024Quote: qRT-PCR was performed (ViiA 7 Real-Time PCR System, Applied Biosystems, USA), and data was collected using the QuantStudio software (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... Amplifications were run using a QuantStudio 7 real-time PCR system (Applied Biosystems) with SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... follicles were treated with 10μM of 2′,7′ dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen- D399) for 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reactions were run on the QuantStudio 6 or 7 (ThermoFisher Scientific, Waltham, MA) using the qPCR reaction settings as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and/or Sept-7-YFP using Lipofectamine™ 3000 Transfection Reagent (ThermoFisher, L3000001). Cells were used 48 hr after transfection.
-
bioRxiv - Microbiology 2024Quote: ... 1 µl of template DNA and 7 µl of nuclease free water (Invitrogen). The reaction mixture was incubated and amplified using Rotor-Gene Q at 65°C for 20 min followed by melt curve analysis at 99-80°C with an increment of 0.2 °C/ s ...
-
bioRxiv - Cancer Biology 2024Quote: HepG2 and HuH-7 cells were maintained in 5 mM Glucose DMEM (Gibco) supplemented with 10% fetal bovine serum and antibiotic supplements (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR was monitored on the ViiA-7 Real-Time PCR system (Applied Biosystems). Relative mRNA expression was then calculated using the ΔΔCT method normalising gene expression to the RPL32 house-keeping gene.
-
bioRxiv - Plant Biology 2020Quote: ... the samples were centrifuged before receiving 50 µL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Systems Biology 2021Quote: ... the samples were centrifuged before receiving 50 μL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1 % trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Dried samples were dissolved in 250 µl of silylation-grade acetonitrile followed by addition of 250 µl of N-methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (TMCS) (Thermo Scientific, Bellefonte, PA) and heated for 1 hr at 70 °C to generate trimethylsilyl derivatives ...
-
bioRxiv - Molecular Biology 2021Quote: ... cryosectioned zebrafish larvae were washed 3x in wash buffer for 5 min and subsequently stained with Filipin solution for 60 min in a humidified dark chamber and co-stained with BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany). Staining solution was removed and slides were washed twice in wash buffer ...
-
bioRxiv - Molecular Biology 2019Quote: The 2′ O-methyl phosphorothioate AOs were transfected into dermal fibroblasts as lipoplexes using 3 μl of Lipofectamine 3000 (Life Technologies, Melbourne, Australia) per 1 ml of OptiMEM ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were stained with CellTrace BODIPY TR methyl ester (1:200 in PDT [1 % DMSO, 0.1 % Triton X-100 in PBS], cat# C34556, Thermo Fisher Scientific, Waltham, MA) for 20 min at RT and/or DAPI (5 mg/ml ...
-
bioRxiv - Plant Biology 2022Quote: ... The sample was dried under a stream of air and resuspended in 50μL of N-methyl-N-(trimethylsilyl) trifuoroacetamide (MSTFA) (Fisher scientific, Waltham, MA, USA), votexed to mix for 20 sec ...
-
bioRxiv - Molecular Biology 2023Quote: The mitochondrial membrane potential was measured using the tetramethylrhodamine methyl ester (TMRM, 50 nM, Life technology, T668) and Mitotracker Green (100nM, Thermo Fisher Scientific, M7514) fluorescent probes according to the manufacturers’ protocols ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Systems Biology 2023Quote: ... Val-Tyr-Val, methoxyamine hydrochloride (MeOX), N-methyl-N-(trimethylsilyl)-trifluoroactamide (MSTFA), and pyridine (Anhydrous, 99.8%) were all purchased from Fisher Scientific (Hampton, NH, USA). Fatty acid methyl esters (FAMEs ...