Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... coli One Shot BL21 (DE3) (Life Technologies). The ARH1 D55,56A ...
-
bioRxiv - Plant Biology 2022Quote: ... a NanoDrop One spectrophotometer (Thermo Fisher Scientific) and Qubit 3.0 Fluorometer (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... One Shot BL21(DE3) (Invitrogen, 44-0184), OverExpress C43 (DE3 ...
-
bioRxiv - Genetics 2023Quote: ... and quantified with NanoDrop One (Thermo Fisher). One μg of the DNA was used as template for dsRNA synthesis using MEGAscript T7 Transcription kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x Culture One (Gibco, #A33202-01) in Neurobasal-A (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a NanoDrop One Spectrophotometer (ThermoFisher Scientific). Equal amounts of protein (0.25 µg ...
-
bioRxiv - Neuroscience 2024Quote: ... with One Shot™ TOP10 (ThermoFisher Scientific) for allele-specific sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... and one µL GlycoBlue (Fisher Scientific, #AM9515) was added to seventy µL of the extracted aqueous phase ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Genomics 2023Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Microbiology 2022Quote: ... and ABI Step One system (Applied Biosystems) were used for quantitative RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... one protease inhibitor mini-tablet (Thermo Scientific) and Benzonase nuclease (Millipore) ...
-
bioRxiv - Cancer Biology 2022Quote: ... An UltraVision ONE Detection System (Thermo Fisher) was used following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... in Step-One plus from Applied Biosystems. gyrA was used as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... PichiaPink™ yeast strain one (Invitrogen, USA) was grown according to the instructions of the manufacturer ...
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... RNA was quantified using NanoDrop One (Invitrogen). Total RNA (5 µg ...
-
bioRxiv - Genomics 2022Quote: ... A NanoDrop One (ThermoFisher Scientific, Waltham MA) spectrophotometer was used to quantify the genomic DNA and determine 260/280 and 260/230 nm ratios ...
-
bioRxiv - Microbiology 2022Quote: ... coli DH5α One Shot Top10 cells (Invitrogen). Transformants were selected based on Zeocin resistance (25 μg mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... One Shot competent cells (Thermo Fisher Scientific) were transformed and candidate colonies were verified by diagnostic digestion ...
-
bioRxiv - Genetics 2023Quote: ... transformation was performed (One Shot Stbl3, Invitrogen). The inserted gRNA sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing one-part DMEM (Fisher Scientific; 41966029) and one-part DMEM/F12 (Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: One Shot Stbl3 competent cells (Invitrogen 1934665)
-
bioRxiv - Systems Biology 2024Quote: ... and one part M199 (Gibco, 31150-022), 2% Cosmic Calf Serum (Hyclone ...
-
bioRxiv - Microbiology 2024Quote: ... TOP10F’ One Shot Competent Cells (Invitrogen 440300) were transformed using 2µl of each ligation reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... FBS One Shot (1X, Thermo Fisher Scientific), Glutamax (1X ...
-
bioRxiv - Molecular Biology 2024Quote: ... quantified as IgG in Nanodrop One (Thermofisher) and stored at –20°C until further use.
-
bioRxiv - Neuroscience 2024Quote: ... and a One-step Cycler (Applied Biosystems). Gene expression was normalized to the housekeeping gene GAPDH.
-
bioRxiv - Biophysics 2024Quote: ... one protease inhibitor mini-tablet (Thermo Scientific) and Benzonase nuclease (Millipore) ...
-
bioRxiv - Cancer Biology 2024Quote: ... One vial of CFSE dye (Invitrogen, C34554) was resuspended in 18 µL of DMSO ...
-
bioRxiv - Developmental Biology 2024Quote: ... and a One-step Cycler (Applied Biosystems). Gene expression was normalized to the housekeeping gene GAPDH.
-
bioRxiv - Immunology 2022Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S ‘2P’ and HexaPro IMAC elution fractions were concentrated to ∼ 1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Immunology 2020Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S-2P IMAC elution fractions were concentrated to ~1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pierce premium grade N-hydroxysulfosuccinimide (sulfo-NHS, PG82071) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 22980) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Immunology 2023Quote: ... viable CD45-CD34+Sca-I- cells were sorted from epidermal single cell suspensions of 1-month-old EGFRΔEgr2 (n=3) and littermate controls (n=3) into Trizol LS Reagent (Thermo Fisher Scientific) using a FACS Aria III ...
-
bioRxiv - Microbiology 2023Quote: ... cells were blocked for 1 h in 3% BSA/PBS and incubated with rabbit-anti-GFP (1:50 in 3%BSA/PBS, 200 µl/well, Invitrogen, G10362) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products (1□μg) of desired templates were 3’ end-labeled using a Pierce biotin 3’ End DNA Labeling Kit (Thermo Scientific). The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA) ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-mouse Alexa-Fluor 488, 1:500, Thermofisher Scientific, 4 hrs at RT; Th: goat anti-rabbit Alexa-Flour 488, 1:500, Thermofisher Scientific, 4 hrs at RT). Sections were mounted on gelatin subbed slides and coverslipped with VectaShield anti-fade mounting medium (Vector Labs).
-
bioRxiv - Cell Biology 2020Quote: ... plasmids (1 μg of guide RNAs +/- 3 μg donor) were diluted in 1 ml OptiMem (Gibco) and 20 ul PEI (1 mg/ml) ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 1/10 volume of 3 M sodium acetate and 1 μL glycogen 10 mg/mL (Thermofisher). Pellet obtained by centrifugation 15000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... mIMCD-3 cells were cultured in 1:1 DMEM high-glucose pyruvate (41966052, GIBCO, Life Technologies): F-12 Nutrient Mixture (21765037 ...
-
bioRxiv - Cell Biology 2024Quote: ... mIMCD-3 cells were cultured in 1:1 DMEM high-glucose pyruvate (41966052, GIBCO, Life Technologies): F-12 Nutrient Mixture (21765037 ...
-
bioRxiv - Immunology 2024Quote: ... cells were diluted 1:3 in PBS with 2 mM EDTA and 1:1000 DAPI (ThermoFisher). Cells were counted using Forward Scatter (FSC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell extracts (20 µg/lane) were fractionated in 3%-8% or 4-12 % tris-acetate gel (NP0006, NuPAGE Life Technologies). All antibodies were used at the concentrations recommended by the manufacturers.
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... IP and lysate samples were separated by SDS-PAGE on precast 3-8% tris-acetate and 4-12% bis-tris acrylamide gels (Invitrogen) followed by transfer to 0.2 μm nitrocellulose membranes (Amersham) ...
-
bioRxiv - Genetics 2020Quote: ... Samples were loaded on 4-12% NuPAGE Bis-Tris gels or 3-8% NuPAGE Tris acetate gels (Thermo Fisher Scientific) and transferred to the nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 ul of each sample and 3% input of each cell lysate was loaded on a 4-12% Bis-Tris pre-cast SDS-page gel (Invitrogen) and transferred to a PVDF membrane (BioRad) ...