Labshake search
Citations for Thermo Fisher :
9951 - 10000 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) by QuantStudio5 (Applied biosystems). The expression of interested genes was normalized to Tubulin for calibration ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed and reacted for 1h at RT with appropriate secondary antibodies (1:1,000; goat anti-rabbit secondary antibody Alexa Fluor 546; #A-10040, ThermoFisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... Reverse transcription was made using around 1μg of total RNA and the Superscript III RT kit (Thermo Fisher Scientific). To qualitatively assess the abundance of cDNA ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) by QuantStudio5 (Applied biosystems). The expression of interested genes was normalized to Tubulin for calibration ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of total RNA was reverse transcribed in a 20 µl reaction using Taqman RT Reagents (ThermoFisher Scientific) with hexamers at 48°C for quantification of viral RNA copies or SuperScript IV Reverse Transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2024Quote: ... secondary antibodies were applied simultaneously for 40 min at RT: donkey anti-rabbit Alexa568 (Thermo Fisher A10042, 1 : 1000), donkey anti-mouse Alexa647 (Thermo Fisher A31571 ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by secondary antibody incubation with species-specific Alexafluor IgG secondary antibodies (90 min at RT, Invitrogen; 1:1000). Tissues were washed again in 0.1% PBST (4 x 15 min) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by incubation for 2h at RT with fluorophore conjugated antibodies goat anti-Rabbit (AlexaFluor, Invitrogen, #A11036, 1:1000) and anti-GST-Dylight 650 (Columbia Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 3 min at RT and coverslips were mounted with Prolong Diamond Mounting Media (Thermo Fisher Scientific, P-36961) on microscope slides ...
-
bioRxiv - Microbiology 2024Quote: ... and complementary DNA (cDNA) was synthesized using the SuperScript III RT kit (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA was synthesized via treatment with reverse transcriptase and oligo(dT) primer (SuperScript III First-Strand Synthesis System; Invitrogen). Quantitative RT-PCR was performed on an ABI7900HT detection system (Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Fragments were purified and used as template for a subsequent amplification using primers MpC1HDZ_gibson_fw and MpC1HDZ_gibson_rv and cloned in a pENTR2B (Thermo Fisher, Waltham, MA, US) using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs Inc. ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA (2 µg) and an anchored oligo(dT) primer were used for cDNA synthesis using SuperscriptTM III Reverse Transcriptase (Invitrogen) as instructed ...
-
bioRxiv - Biochemistry 2020Quote: ... of with sgRNA (see Table S3 for plasmids and Table S4 for primers) using Lipofectamine LTX with Plus Reagent (A12621, Thermofisher) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... one μg RNA was reverse-transcribed using Oligo(dT)18 primer and Superscript III (Invitrogen, Thermo Fisher Scientific, Waltham, MA). Kras cDNA was amplified in PCR reaction using the corresponding primers (Reagents ...
-
bioRxiv - Cancer Biology 2021Quote: ... one μg RNA was reverse-transcribed using Oligo(dT)18 primer and Superscript III (Invitrogen, Thermo Fisher Scientific, Waltham, MA). Kras cDNA was amplified in PCR reaction using the corresponding primers (Reagents ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was reverse transcribed using the TaqMan miRNA Reverse Transcription Kit and miRNA-specific stem-loop primers (Applied BioSystems) in a small-scale RT reaction [comprised of 0.19 μL of H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... were PCR amplified with BamHI and NotI sites in the forward and reverse primers and the products cloned into pcDNA5/FRT/TO (Invitrogen) containing GFP or GFP-H2B ...
-
bioRxiv - Cell Biology 2020Quote: ... was used with random primer mix to make cDNA according to the manufacturer’s instructions in a Veriti 96-well Thermal Cycler (Applied Biosystems). All quantitative polymerase chain reactions (qPCRs ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was made from 150 or 200 ng of total RNA using oligo (dT) primer with SuperScript IV reverse transcriptase (Invitrogen). qPCR was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... Primers and probes for ddPCR assays were designed using the TaqMan MGB Allelic Discrimination option in Primer Express 3.0 software (Life Technologies). Sequences of the primers used in the genotyping reactions are described in Table MM.2.
-
bioRxiv - Molecular Biology 2020Quote: ... according to manufacturer’s instructions then reverse transcribed with an oligo(dT)20 primer using the Superscript III cDNA First Strand Synthesis kit (Invitrogen). The qPCR reaction was set up using the KAPA SYBR FAST ABI Prism kit (KAPA Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... SFB was quantified by qPCR with primers specific for 16S SFB rRNA genes (SFB F- sequence/SFB R- sequence)using Hot Start-IT SYBRGreen (Affymetrix) on the Roche real-time PCR system (Roche 480) ...
-
bioRxiv - Microbiology 2019Quote: ... the promoter region of the entCEBA operon was amplified from E2348/69 or MC4100 using the primers PentCluxF and PentCluxR (table S2) and the high fidelity Phusion DNA polymerase (ThermoFisher) according to the manufacturer’s protocol with the addition of 10% betaine ...
-
bioRxiv - Developmental Biology 2021Quote: ... gRNA templates were generated with PCR using a pool of 3 different gRNA primers at equal concentrations and were in vitro transcribed using the mMESSAGE T7 Kit (Invitrogen). The final concentration of gRNAs was adjusted to 1600 ng/µl.
-
bioRxiv - Microbiology 2021Quote: ... 11 µl of nucleic acids were incubated for 2 min at 72°C with 100 pmol of primer A (5’GTTTCCCACTGGANNNNNNNN3’) followed by a reverse transcription step using 200 units of Superscript III (Invitrogen) at 50°C for 60 min with a subsequent Klenow DNA polymerase step using 5 units (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cDNA was synthesized using the SuperScriptTM III First-Strand Synthesis SuperMix Kit and random hexamer primers (ThermoFisher, Rockville, MD). Quantitative real time RT-PCR (qPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both constructs were amplified with primers (Table S1) containing attB for Gateway cloning into pDONR221 using BP Clonase II (Invitrogen). pDONR221 clones were verified by sanger sequencing (eurofins) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gene sequence of TTL3 gDNA was amplified (primers TTL3-gDNA-LP and TTL3-gDNA-BP, Table S1) and subcloned into the pDONR221 (Invitrogen). GFP CDS was cloned into the pEN-R2-F-L3.0 vector (Karimi et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... was amplified (primers pTTL3-LP and pTTL3-BP, Table S1) and subcloned into the pENTR5’-TOPO TA Cloning vector (Invitrogen). The gene sequence of TTL3 gDNA was amplified (primers TTL3-gDNA-LP and TTL3-gDNA-BP ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... Specific primers and probes targeting the WPRE element (WPRE v1; Supp. Table 1) of the integrating lentiviral vector and Actb (ThermoFisher), as a housekeeper ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNAs for the qPCR were synthesized from 500 ng of total RNA using random hexamer primers (Thermo Fisher Scientific) and RevertAid Reverse Transcriptase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... position 132-480 of 828 bp ORF) were amplified from genomic DNA with primers containing attB1 sites for BP recombination (Invitrogen) into the stem-loop RNAi vector pGL2084 (67) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was quantified using TaqMan Gene expression assays and the TaqMan primers to target genes were purchased from Thermo Fisher Scientific listed in Table 1 ...
-
bioRxiv - Genomics 2020Quote: ... with 900nM target and reference primers (Integrated DNA Technologies) and 250nM of target and reference probes (Thermo Fisher Scientific, US). Reactions were quantified using a QX100 instrument and analysed with QuantaSoft v1.3.1.0 (BioRad ...
-
bioRxiv - Cell Biology 2019Quote: ... the indicated primer pairs were mixed with 1ng of pAcGFP-C1-IGF2BP1 plasmid in 1X Phusion High-Fidelity DNA Polymerase (F530L, ThermoFisher) mix at a final volume of 50 µl ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 30 ng cDNA was used as a template in reactions with 0.5 µM of forward and reverse primers (18) and SYBR Green (Applied Biosystems). Control samples were prepared that lacked M-MLV ...
-
bioRxiv - Genomics 2019Quote: ... The first strand reaction was performed using a reverse poly dT DNA primer containing two anchors and the attB Gateway BP recombination element (Invitrogen). The second strand of the cDNA was synthesized using a PCR with HiFi taq polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... 6 μg of total RNA was incubated with 1.4 μg of anchored Oligo(dT)20 primer (Invitrogen, Carlsbad, CA, USA) in a total volume of 18.5 μl for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... and sequenced with the primers indicated in Extended Data Table 5 using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a 3130xl Genetic Analyzer (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The obtained cDNA was amplified using specific primers (Supplementary Table 1) and the PowerUp SYBR Green Master Mix (Thermo Scientific). Expression of target genes was analyzed using the 2-ΔΔCt method with normalization with GAPDH and comparison of expression between non transfected (Control ...
-
bioRxiv - Cell Biology 2019Quote: ... An aliquot of total RNA was reverse transcribed using an oligo (dT) primer (SuperScript TM III First-Strand Synthesis System, Invitrogen). For the thermal cycle reactions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Templates were generated by PCR (see Supplementary Table 1 for primer sequences) and in vitro transcription was carried out using the MEGAscript T7 transcription kit (Invitrogen). RNA was isolated by phenol/chloroform extraction and ethanol precipitation.
-
bioRxiv - Bioengineering 2020Quote: ... qPCR was performed using primers BT-1F and BT-1R (Table S3) and PowerUp SYBR Green Master Mix (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2019Quote: ... with Strep and His epitope tags was amplified by PCR from pIEx10-LRIM1 (Povelones et al. 2009) with BamHI tagged primers (LRIM1-F, LRIM1-R) and subcloned into pJET1.2 (Thermo Scientific) before cloning into pslVg-BGH-attP ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg RNA was used to synthesize cDNA by reverse transcription with oligonucleotide dT primers using SuperScript Reverse Transcriptase III (Invitrogen). Gene-specific primers were used to perform qPCR on the ABI 7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... primer hybridization was done with 2.5 µM of anchored oligo(dT)10 INSTA-seq reverse transcription primer in DEPC-2xSSC with 0.5 U/µl of SUPERase (AM2696, ThermoFisher Inc) overnight at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... and mir152 specific primers with NCode miRNA First-Strand cDNA Synthesis qPCR Universal Primer in a fast mode SybrGreen reaction at the QuantStudio 5 (Thermofisher). We used RNU6B and RNU44 as endogenous controls ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...