Labshake search
Citations for Thermo Fisher :
9651 - 9700 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... on Quantstudio 3 Real-Time PCR System (ThermoFisher) using the following protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... in RNase free PCR strips (Thermo Fisher, USA). RNase-free water was added to a final volume of 16 µL ...
-
bioRxiv - Immunology 2022Quote: ... using SYBR Green PCR Core Reagents (Applied Biosystems). The reaction mixtures were incubated for 10 min at 95 °C ...
-
bioRxiv - Genetics 2022Quote: ... and StepOne Real-Time PCR System (Applied Biosystems). Samples amplified with the Beta-Actin primers were diluted 1:100 ...
-
bioRxiv - Genetics 2022Quote: ... 2.5 μL 10X Mg-free PCR buffer (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... 1 μL 10X Mg-free PCR buffer (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... PCR was performed with DreamTaq (ThermoFisher, Waltham, MA) and the included reagents with an initial denaturation at 94°C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... purified using the GeneJet PCR purification kit (ThermoFisher), and 1 μg was used to generate dsRNA using a HiScribe T7 RNA synthesis kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... Phire Animal Tissue Direct PCR Kit (Thermo Fisher) was used according to manufacturers’ instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the QuantStudio 3 PCR system (Thermo Fisher). Primer sequences were as follows ...
-
bioRxiv - Systems Biology 2022Quote: ... 12.5 ul Phusion PCR master mix (Thermo Scientific), 1.25ul of 10uM forward and 1.25ul of 10uM reverse index primers were added to a total volume of 25ul ...
-
bioRxiv - Molecular Biology 2023Quote: ... we used SYBR Select PCR Master Mix (ThermoFisher). ΔCt values of the target genes were normalized against the spike-in RNAs from yeast and fly genes ...
-
bioRxiv - Neuroscience 2023Quote: ... a ViiA Real-Time PCR System (Applied Biosystems). Experiments were conducted in multiplexing to obtain relative levels of each transcript normalized for the endogenous controls GAPDH ...
-
bioRxiv - Neuroscience 2023Quote: ... instrument using SYBR Green PCR Master Mix (Invitrogen). PCR amplification conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... on StrepOnePlus real-time PCR system (Applied Biosystems). Relative mRNA expression was calculated by 2-DDCt method and normalized to GAPDH transcripts.
-
bioRxiv - Physiology 2023Quote: ... Platinum Direct PCR Universal Master Mix (ThermoFisher, A44647500) was used for DNA isolation and PCR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DreamTaq™ Green PCR Master Mix (ThermoFisher Scientific), endonuclease DpnI and BbsI (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2022Quote: ... using TaqMan Universal PCR master mix (Applied Biosystems) and pre-designed TaqMan probes (TaqMan Gene Expression Assays ...
-
bioRxiv - Immunology 2022Quote: ... and Universal PCR Master Mix (Applied Biosystems™) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using SYBR Green PCR Master Mix (Life Technologies) and the following primers GTCCTACTTCATCCGCCTTTAC and TCGTCTGCAAAGTTCAGCC for WASP and GGCATGGACTGTGGTCATGAG and TGCACCACCAACTGCTTAGC for GAPDH.
-
bioRxiv - Neuroscience 2022Quote: ... using TaqMan Fast Universal PCR Mastermix (Applied Biosystems) and compared with hypoxanthine phosphoribosyltransferase 1 (Hprt1 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were cloned in pCR2.1 TOPO (Invitrogen) and sequenced ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was performed with Flash PHUSION polymerase (ThermoFisher). The amplified products and the linearized N-his pETite vector were transformed in HI-Control10G Chemically Competent Cells (Lucigen ...
-
bioRxiv - Plant Biology 2022Quote: ... on a ProFlex PCR system (Thermo Scientific, UK). PCR reaction conditions were as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... and TaqMan Universal PCR Master Mix (Applied Biosystems). The specifically designed primers and the product numbers of the TaqMan Gene Expression Assay were listed in Supplementary Table S5 ...
-
bioRxiv - Plant Biology 2022Quote: ... qPCR was performed by ABI Quantstudio 6 Flex PCR program (Thermo Fisher Scientific), with the actin genes in M ...
-
bioRxiv - Immunology 2022Quote: ... on Quantstudio 7 Real-Time PCR System (ThermoFisher). Relative quantification was calculated by 2-ΔΔCt method described previously49 ...
-
bioRxiv - Cell Biology 2022Quote: ... on a StepOne Real-Time PCR System (ThermoFisher). Gene expression analysis from cell lines and mouse and human islets was performed as described ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR fragments were introduced into pDONR207 vector (Invitrogen) by BP recombination and transferred by LR recombination into destination vectors (Table S3) ...
-
bioRxiv - Neuroscience 2024Quote: ... The QuantStudio 3 Real Time PCR system (ThermoFisher) was used to carry out qPCR reactions ...
-
bioRxiv - Microbiology 2024Quote: ... 2.5 μL 10X High Fidelity PCR Buffer (Invitrogen), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Immunology 2024Quote: ... The ViiA 7 Real-Time PCR System (ThermoFisher) was employed with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2× DreamTaq PCR Master Mix (Thermo Fisher Scientific) and 1 nM final concentration of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... in a PCR plate 384-well (Thermofisher, AB1384) and using a Quantstudio 12K Flex Real-time PCR System instrument (Thermofisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... A QuantStudio 5 Real-Time PCR System (ThermoFisher) was used to perform the qPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 96-well PCR plates (Applied Biosystems™, #4346906) were used to carry out the qPCR reaction with each well comprising of 1μl of the forward and reverse primer mix ...
-
bioRxiv - Molecular Biology 2024Quote: The StepOnePlus Real-Time PCR System (ThermoFisher Scientific) was used to execute the quantitative real-time PCR reactions.
-
bioRxiv - Microbiology 2024Quote: ... in a GeneAmp PCR system 2400 (Applied Biosystems).
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... using SYBR Green PCR Master Mix (Applied Biosystems). Target cDNA levels were analyzed by the comparative cycle (Ct ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Diagnostic PCRs (Taq DNA polymerase, Thermo Fisher Scientific) were routinely used to confirm genome edits and kanMX insertions ...
-
bioRxiv - Genomics 2024Quote: ... The StepOnePlus Real-Time PCR System (Applied Biosystems) was used with threshold cycle number was determined using Opticon software ...
-
bioRxiv - Microbiology 2024Quote: ... and a StepOnePlus real-time PCR device (ThermoFisher). The primers used are listed in Supplementary Table 3 ...
-
bioRxiv - Microbiology 2024Quote: ... and a StepOnePlus real-time PCR machine (ThermoFisher). The PCR reaction contained 2.5 ng of genomic DNA ...
-
bioRxiv - Immunology 2024Quote: ... on StepOne Real-Time PCR System (Thermo Fisher). β-actin was used as the house-keeping gene ...
-
bioRxiv - Bioengineering 2024Quote: ... they were PCR amplified using Accuprime Pfx (Invitrogen) as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... with TaqMan Universal PCR Master Mix (Applied Biosystems). The relative mRNA expression of the targeted genes was normalized to the GADPH as endogenous control ...
-
bioRxiv - Genomics 2023Quote: ... We used a PCR machine (SimpliAmp, Applied Biosystems) programmed to run a “stepdown” protocol ...
-
bioRxiv - Immunology 2023Quote: ... in QuantStudio3 Real-Time PCR System (Applied Biosystems). All expression values were normalized to GAPDH or Rpl32 mRNA level.
-
bioRxiv - Microbiology 2023Quote: ... Platinum Hot Start PCR master mix (ThermoFisher Scientific), 515F and 806R primers (Bioneer) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the SYBR Green PCR Master Mix (Thermo Fisher) was used according to the manufacturers protocol ...