Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... with 5% FCS (Gibco), MEM only ...
-
bioRxiv - Neuroscience 2023Quote: ... and penicillin/streptomycin (GIBCO)] and 5% FBS (GIBCO). After 2 hours incubation ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). Lysis of the cells was performed using RLT lysis buffer (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). After 72h stimulation ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% goat serum (Gibco), and 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% FBS (Gibco) and 1% glutamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% mouse serum (Invitrogen) and 5% rat serum (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.5% w/v sodium dodecyl sulfate) to which 400 μl of warm 5:1 Acid Phenol:Chloroform (Ambion, cat. # AM9722) were added and the resulting phase-separated mixture was agitated by vortexing at maximum speed for 15 sec ...
-
bioRxiv - Cell Biology 2021Quote: ... Isolated EVs in PBS (5 - 10 μg protein) were acidified with trichloroacetic acid (TCA; Fisher Scientific, Cat #A322-100) (10% vol:vol final ...
-
bioRxiv - Genomics 2021Quote: ... Samples were transferred to 1.5 mL safe-lock tubes containing one scoop of acid-washed glass beads (<106μM) and 1 mL TRIzol (Invitrogen) containing 20μg/mL GenElute-LPA (Sigma-Aldricht ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were resuspended in sorting buffer (0.2% BSA in PBS) containing 5 nM SYTOX Green Nucleic Acid Stain (catalog number S7020; ThermoFisher) to distinguish between live and dead cells ...
-
bioRxiv - Bioengineering 2022Quote: ... The following reagents were used as received: 2,4,6-trinitrobenzene sulfonic acid 5% weight/volume methanol solution (Thermo Fisher Scientific), N-Boc-hydroxylamine (Alfa Aesar) ...
-
bioRxiv - Biochemistry 2020Quote: ... buffer B: 0.2% formic acid and 5% DMSO in acetonitrile) in a Dionex Ultimate 3000 LC-system (Thermo Scientific). Peptides were then analyzed using a LTQ Orbitrap Elite mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cell medium was replaced by fresh medium supplemented with 5 µM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) as a background stain for high-content imaging analysis ...
-
bioRxiv - Immunology 2023Quote: ... and the extraction was repeated with 50 % ACN / 5 % Formic Acid (HCOOH) (LC-MS Grade, #85178, Thermo Fisher Scientific). The solution was dried in vacuum centrifugation for 2 hours 30 minutes (maximum vacuum pressure up to 5.1 ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then stained with 5 µM of sytox green (SYTOX™ Green Nucleic Acid Stain, 57020, Invitrogen) prepared in sterile PBS ...
-
bioRxiv - Microbiology 2024Quote: ... and cells were stained for 15 min with 5 μM green fluorescent nucleic acid stain SYTO™ 9 (Invitrogen) at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... selenous acid (5 ng mL-1)]) and penicillin-streptomycin (1v/v%, Gibco™ Ref 15140122, Grand Island, NY, USA). Subcultivation of monolayers was performed at 70–80% confluence by detachment using TrypLE (Gibco™ Ref 12604013 ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by sonication three times for 5 seconds with 5 seconds intervals at #5 (on dial) (Fisher Scientific 60 Sonic Dismembrator) on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were cultured at 37 °C in a humidified incubator at 21% oxygen/5% CO2 or 5% O2/5% CO2 (HeraCell Tri-Gas, ThermoFisher Inc).
-
bioRxiv - Cell Biology 2020Quote: The 5’ and 3’ ends of lncRAP2 was determined using the FirstChoice RLM-Race Kit from Ambion following the manufacturers instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... HCT116 cells complemented with chromosomes 3 and 5 were cultured with 400 μg/mL geneticin (G418, Gibco) and 6 ug/mL blasticidine (Invivogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Staining of cells was performed using 5 μl of DiBAC4(3) (Invitrogen, 0.025 mg/ml in DMSO) followed by incubation for 15 minutes at room temperature in dark ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-CAGGAAACAGCTATGAC-3’) and was subsequently recombined with the destination vector using LR Clonase (Thermo Fisher Scientific). The plasmids were then transformed in Agrobacterium tumfaciens strain GV3101.
-
bioRxiv - Cell Biology 2021Quote: ... Sections were washed 3-5 times with TBSTX buffer and then mounted on Superfrost slides (Fisher Scientific) with Slow fade Diamond mounting solution (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse ENKD1 shRNA (nucleotides targeting 403-423 bp, 5′-CGCTCACCCAAGTATGACAAT-3′) were cloned into pLKO.1 (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... Reverse 5’-CGA AGG TGT GAC TTC CATG-3’) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). A standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Molecular Biology 2020Quote: ... while the EASY-Spray C18 column (Thermo Scientific, 15 cm×75 μm ID, 3 μm, 5 μm) was used as the analytical column ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-\56-FAM\ CCT ACC TTA ACC TCC C-3’ with Minor Groove Binder (MGB; ThermoFisher Scientific). PCR was performed using 10X Master Mix to yield a final volume of 25 µl and final working concentrations of 16.6mM (NH4)2SO4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were thawed at room temperature and washed 3 times 5 minutes in DPBS (Gibco, 14190-094). Sections were then counterstained for 5 minutes with Hoechst 33342 (1μg/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... 5′-CCCAAGACTTCCACCTACATTC -3′ (Tm = 62°C) and subsequently subcloned into PCR II-TOPO-TA cloning vector (Invitrogen). Riboprobes were generated with a BIOT-NTP labeling kit (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... Primers used to amplify the 5’/3’ junction with Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific) are listed in Table S3 ...
-
bioRxiv - Microbiology 2022Quote: ... Data analysis was performed with the Quantstudio 3&5 Design and analysis software (version v1.5.1, Applied Biosystems). Cq values were obtained via automated threshold determination ...