Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Immunology 2020Quote: ... tryptic peptides obtained from StageTip-based SCX fractionation were reconstituted in 0.1% formic acid and loaded on a nanoViper 2 cm (3 µm C18 Aq) trap column (Thermo Fisher Scientific). Peptide separation was carried out using EASY-Spray C18 analytical column (50 cm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Peptides were acidified to pH 2-3 using trifluroacetic acid (TFA) prior to LC-MS analysis on a Dionex U3000 UHPLC system (ThermoFisher Scientific) equipped with a column chromatography setup coupled to a Q Exactive Plus Orbitrap MS (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed on QuantStudio™ 3 and 5 Real-Time PCR System (Thermo Fisher Scientific, USA) using KAPA SYBR®Fast qPCR Master Mix (Kapa Biosystems).
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed 3 x 5 min and incubated for 10 min with DAPI (1/2000, Invitrogen #D1306) diluted in PBT + 0.5% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 minutes followed by a wash with chilled PBS and blocked with 3% goat serum (Thermo Scientific) for 1h at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 μl of purified γ-TuRC was visualized on an SDS-PAGE with SYPRO Ruby stain (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... hBMSCs (passage 3) were expanded at 37°C and 5% CO2 in expansion medium (Dulbecco’s modified Eagle’s medium (DMEM; GIBCO) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... by incubating muscles twice for 45 min in preoxygenated Ringer containing 5 μM Rhod-3 AM (Life Technologies), 0.02 % Pluronic acid (Life Technologies ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... Reverse 5′-CGA AGG TGT GAC TTC CAT G-3′) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Neuroscience 2020Quote: ... brain sections from 3- to 5-month-old mice were exposed to 2.5 µM MitoSOX Red (Molecular Probes), at 37°C for 30 min14 ...
-
bioRxiv - Plant Biology 2020Quote: ... The solution was sonicated for 3-5 mins using an ultrasonic cleaner (FS220, Thermo Fisher Scientific, Waltham, MA). The solution was diluted to 10 mL with 2% nitric acid ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 to 20 ng of RNA were amplified and labelled with the GeneChip 3’ IVT Pico Kit (Affymetrix) according to manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 3 to 5 min in 100 μM Lysotracker-Red DND-99 (Life Technologies, Carlsbad, CA, USA)[49] and 1 μM Höchst 33342 (Thermo Fisher Scientific Inc ...
-
bioRxiv - Genomics 2020Quote: ... slides were washed 3 times for 5 min with TNT and mounted with Prolong Gold (P36930, Life Technologies).
-
bioRxiv - Plant Biology 2021Quote: ... The bands were detected by using SuperSignal pico/femto chemiluminescence kits (Thermo Scientific; #’s1859022/3 and 1859674/5).
-
bioRxiv - Biochemistry 2020Quote: ... 3 μg/mL gentamicin (Wisent) and 5 ng/mL recombinant mouse fibroblast growth factor basic (FGF-b, ThermoFisher). At ~90% confluence ...
-
bioRxiv - Immunology 2020Quote: ... 5% CO2 and medium were changed every 3 days and cells were passaged with 0,05% trypsin-EDTA (Invitrogen) twice per week.
-
bioRxiv - Genomics 2020Quote: ... Biotin labelled fragments which contained the 5’ and 3’ connecting region was enriched using Dynabeads M280 streptavidin (Invitrogen) and incubating at room temperature for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: 5’ - capped and 3’- polyadenylated hCas9-2xNLS mRNA was transcribed in vitro using mMessageMachine T7 (ThermoFisher, Cat# AM1344) and Poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR (RT-PCR) were performed on a QuantStudio 3 or QuantStudio 5 machines (Thermo Fisher Scientific). Primers/probe sets from Applied Biosystems were selected from the Thermo Fisher Scientific website (Supplementary Table 3) ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Molecular Biology 2023Quote: ... An RNA linker (5’-CACGACGCUCUUCCGAUCU-3’) was ligated to the polyA RNA with T4 RNA ligase (Thermo Scientific) to capture RNAs with a 5’ monophosphate (5’P) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Slides were again washed with PBS-/- 3×5 min and mounted using Prolong Gold Antifade Mountant (Thermo Scientific). Sections stained with secondary only antibodies were included to determine fluorescence threshold before image acquisition in each channel ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Sections were washed 3 times 5 minutes in PBS and mounted using ProLong Gold mouting media (Thermo Fisher) under glass cover slips.
-
bioRxiv - Microbiology 2024Quote: ... exponentially growing cells in suspension were diluted to 3×109 and 5 µl spotted on 1.5% agar (Gibco) supplemented with 0.5% CTT and immediately covered with a coverslide ...
-
bioRxiv - Developmental Biology 2023Quote: ... rtf1-e3 gRNA (target sequence: 5’-GGAAGAAGGGGAAACCGAGCAA-3’) was synthesized using the MEGAshortscript T7 Transcription Kit (ThermoFisher Scientific) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... washed 3 x 5 min with PBS and incubated with Alexa Fluor-488 goat anti human secondary (Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed 3 x 5 min with TBST and developed using chemiluminescent substrate (Thermo Scientific SuperSignal West) and imaged using a BioRad Chemidoc.
-
bioRxiv - Neuroscience 2023Quote: ... and then washed with PBS 3 x 5 min and mounted with ProLong Gold Antifade Mountant (ThermoFisher, P36930). Mounted coverslips were then imaged on a Zeiss Axio Observer-Z1 widefield microscope equipped with a Zeiss Plan-Apochromat 63x / 1.4 Oil objective ...
-
bioRxiv - Cell Biology 2023Quote: The full length Aff3ir mRNA was cloned using commercially available 5’-RACE and 3’-RACE kits (ThermoFisher Scientific) according to the protocols provided ...
-
bioRxiv - Microbiology 2022Quote: ... Vero-E6 cells and Calu-3 were treated with 5 μg/ml or 1 μg/ml puromycin (Gibco), respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were passaged in clumps at ∼ 70% confluency every 3 – 5 days by dissociation with Versene (Life Technologies) at typical ratios between 1:6 and 1:12 ...
-
bioRxiv - Physiology 2024Quote: ... 1x 3–5 min with PBS + 1ng/mL DAPI and mounted in ProLong Gold antifade reagent (Life Technologies).
-
bioRxiv - Cell Biology 2024Quote: ... Slides were washed 3 × 5 min in PBS and embedded into ProLong Diamond Antifade Mountant (Thermo Fisher Scientific). For control experiments ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Passaging was performed by brief (3-5 minute) treatment with 0.5 mM EDTA and 0.25X TRYPLE Express (Gibco) in phosphate-buFered saline (PBS) ...
-
RNA Binding of GAPDH Controls Transcript Stability and Protein Translation in Acute Myeloid LeukemiabioRxiv - Cancer Biology 2024Quote: Total RNA was isolated from 3-5 × 106 cultured MOLM-13 cells using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Cryo-STET data were collected using the STEM Tomography software (Fig. 2A, Fig. 3, Fig. 5; Thermo Fisher) or SerialEM (Fig ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... intestinalis was used for 3’RACE and 5’RACE experiments using FirstChoice™ RLM-RACE Kit (Invitrogen, AM1700) following the manufacturer’s protocol and with the following CiTCF-specific primers ...
-
bioRxiv - Cell Biology 2024Quote: ... as such: position (636-653 bp) 5’ aCAcTAtCAgAGgGAtAT 3’ (modified region corresponding to siRNA from Thermo Fisher s38909) and position (1235-1252 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... as such: position (111-131 bp) 5’- GAaTCgAGtCTaGAgTCtAgc-3’ (modified region corresponding to siRNA from Thermo Fisher s226949) and position (607-627 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... as such: position (1411-1431 bp) 5’ aGaAAaCTgCTgAGgGTgTTa 3’ (modified region corresponding to siRNA from Thermo Fisher s228499) and position (2164-2187 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... RD18 and JR1 cells were cultured for 2-5 days in DMEM supplemented with 2% horse serum (Gibco, Carlsbad, CA, USA) at 90-95% confluency ...
-
bioRxiv - Cancer Biology 2024Quote: ... and washed four times with PBS (2 x quick, 2 x 5 min) prior to incubating with streptavidin conjugated to AlexaFluor647 (Thermo Fisher) diluted in high-salt buffer (0.5 M NaCl ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted from ∼2-5 mg of dechorionated 0–2 hr embryos per biological replicate using TRIzol Reagent (#15596026, ThermoFisher Scientific) and treated with1 μL TURBO Dnase (2 U/μL ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Peptide mixtures were separated at a 400 nl/min flow rate using a 35 min ACN gradient in 0.5% acetic acid (5–38% ACN gradient for 23 min followed by 38-60% ACN gradient for 3 min and 60-95% ACN gradient for 2 min plus another 3 min at 95% CAN prior to 95%-5% gradient for 2 min and another 2 min at 5% ACN) and detected on an Q Exactive HF mass spectrometer (Thermo Scientific). Dynamic exclusion was enabled for 20 sec and singly charged species ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...