Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Microbiology 2024Quote: ... Nuclei were stained for 5 minutes in 5 μg/ml Hoechst 33258 dye (Thermofisher), and washed twice more in 1x PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... a C18 PepMAP 100 trap column (0.3 x 5 mm, 5 μm, Thermo Scientific) and a custom 30 cm C18 main column (75 µm inner diameter packed with ReproSil-Pur 120 C18-AQ beads ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 2 mM essential amino acids (Invitrogen), 10 units.ml−1 penicillin ...
-
bioRxiv - Immunology 2020Quote: ... containing 2 mM ethylenediaminetetraacetic acid (EDTA; Invitrogen AM9261), 2 mM L-glutamine (Gibco 25030) ...
-
bioRxiv - Immunology 2022Quote: ... nonessential amino acids (Cellgro) and 2-mercaptoethanol (Gibco). Cells were stimulated with 50 ng/mL PMA plus 100 ng/mL Ionomycin (Cell Stimulation Cocktail ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2% B27™ w/o retinoic acid (Gibco), 1% N2 (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2% B27™ w/o retinoic acid (Gibco), 1% N2 (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% MEM Non-Essential Amino Acids (Gibco 11140050), and 25mM HEPES buffer (Gibco 15630080) ...
-
bioRxiv - Immunology 2021Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020) ...
-
bioRxiv - Immunology 2022Quote: ... 20 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco) and 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020 ...
-
bioRxiv - Systems Biology 2020Quote: ... Disulfide bonds were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) at RT for 1 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... TMT reaction was allowed for 2 hours and quenched with 5% hydroxylamine (90115, Thermo Fisher Scientific). All the samples were pooled and dried in a SpeedVac (EP022822993 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of sgRNA plasmid was transfected to PLC/PRF/5 cells using Lipofectamine 3000 (Invitrogen). After 2 days’ culture in DMEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the first wash including 5 µg/ml DAPI (4′,6-diamidino-2-phenylindole; ThermoFisher Scientific) to stain nuclei ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were loaded with Fura-2 AM at 1 μg/mL (108964-32-5, Life Technologies) in HBSS or Fluo-4 AM at 10 μM in (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... mice were injected intraperitoneally with 2.5 mg of 5-ethynyl- 2’-deoxyuridine (EdU; Thermo Fisher Scientific). Lungs were harvested ...
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... pre-coated (5 μg cm−2) 4-well chamber slide (Thermo Fisher Scientific, cat. no. 154526). A fluorescence image was captured using an LSM 880 confocal microscope (Carl Zeiss AG ...
-
bioRxiv - Immunology 2023Quote: ... added to 2 μL of TruCut Cas9 Protein v2 (5 ng/μL, Thermo Fisher Scientific A36498), and incubated for 10 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...
-
bioRxiv - Cell Biology 2022Quote: 200,000 cardiomyocytes were incubated in Amplex Red (5 μM; 2 min) for cellular ROS (A22177, ThermoFisher), or MitoSOX Red (5 μM ...
-
bioRxiv - Immunology 2022Quote: ... 2-5×106 cells were incubated in 15 μl Indo-1 solution in 1ml IMDM (Gibco) + 1%FBS (Sigma ...