Labshake search
Citations for Thermo Fisher :
9251 - 9300 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... mouse BM-MSCs were transfected with a Crif1 lentiviral overexpression vector (pLV[Exp]-EGFP:T2A:Puro-EF1A>mGadd45gip1 [NM_183358.4]) constructed by Cyagen Biosciences (vector ID: VB180112-1182ypt) and selected with 5 μg/ml puromycin dihydrochloride (A1113803, Invitrogen). An empty vector (pLV[Exp]-EGFP:T2A:Puro-Null ...
-
bioRxiv - Molecular Biology 2020Quote: Human HCT116 cells (ATCC) were cultured at 37°C under 5% CO2 in McCoy’s 5A media (Thermo Fisher Scientific) with 1x penicillin/streptomycin and 10% FBS (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μL of samples and 5 μL of standards were diluted into 95 μL of 1X SYBR Green (Invitrogen) in TE buffer and mixed by pipette ...
-
bioRxiv - Physiology 2021Quote: ... at 37 °C under microaerobic (5% O2) conditions in a HERAcell 150i CO2 incubator (Thermo Fisher Scientific, Waltham MA). H ...
-
bioRxiv - Molecular Biology 2021Quote: ... SDS-PAGE gels were loaded with 5 - 15 μL of lysate per lane (NuPAGE 4-12% Bis-Tris; Invitrogen). Lysates were diluted with additional 1x NuPAGE LDS buffer if necessary ...
-
bioRxiv - Neuroscience 2020Quote: ... The tissue was washed twice with 5 ml Hibernate-A including 1 mg/ml protease inhibitor (Thermo Fisher, 78442) and briefly triturated in 2 ml of Hibernate-A medium using fire-polished glass Pasteur pipettes until a single-cell suspension was obtained ...
-
bioRxiv - Molecular Biology 2020Quote: ... were cultured at 37 °C in 5% CO2 in medium composed of high glucose Dulbecco’s modified eagles medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cancer Biology 2019Quote: ... MCF10A (CRL-10317) cells were cultured in DMEM /F12 Ham’s Mixture supplemented with 5% Equine Serum (Thermofisher Catalog # 16050130), EGF 20 ng/ml (Sigma) ...
-
bioRxiv - Pathology 2020Quote: ... for 5 min at room temperature and slides were mounted with Prolong diamond mounting medium (Thermo Fisher Scientific, #P36961). Images were acquired with a confocal laser scanning microscope (Zeiss LSM 980 ...
-
bioRxiv - Physiology 2021Quote: ... Frozen tissues were mechanically homogenized with 1 stainless steel bead (5 mm) in 1 ml Trizol (Thermo Fisher Scientific) by shaking for 50 s at 30 Hz (TissueLyser ...
-
bioRxiv - Systems Biology 2019Quote: ... Fixed cells were prepared for the Drop-seq run by centrifugation (1000 g, 5 min) and resuspension in 1 ml of PBS-BSA 0.01% + RiboLock (ThermoFisher) (0.8 U/µl) ...
-
bioRxiv - Systems Biology 2019Quote: ... Fixed cells were prepared for the Drop-seq run by centrifugation (1000 g, 5 min) and resuspension in 1 ml of PBS-BSA 0.01% + RiboLock (ThermoFisher) (0.8 U/µl) ...
-
bioRxiv - Immunology 2020Quote: ... and the cell pellet was suspended in 5 mL 10X RBC lysis buffer (Thermofisher, cat. no. 00-4300-54) diluted 1:10 with distilled water ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 min) and resuspended in 1 ml PBS containing 8 µl UltraPure BSA (50mg ml−1; AM2616, ThermoFisher Scientific) and filtered over Flowmi 40µm cell strainers (VWR ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by 1 h incubation with 1:1,000 anti-mouse Alexa Fluor 488 conjugated secondary antibody (diluted with PBS containing 5% BSA, Invitrogen) at RT in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... Lysate equivalent to 5 mg of total protein was incubated with 30 μl anti-myc magnetic beads (Thermo scientific) for 2.5 hr at 4°C with rotation ...
-
bioRxiv - Microbiology 2020Quote: ... Germany) and were grown at 5% CO2 and 37 °C in Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo Fisher Scientific) supplemented with 1% Penicillin/Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... all grown at 37 °C and 5% CO2 and supplemented with 1% penicillin-streptomycin (Life Technologies Australia Pty. Ltd) A549 cells were grown in Ham’s F-12K (Kaighn’s ...
-
bioRxiv - Microbiology 2020Quote: ... and the wells were overlaid with 4 ml/well DMEM with 5% FBS and 0.7% agarose (Invitrogen, 16500-500). At 6 d.p.i. ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of each culture were spotted onto a TSA plate containing 5% sheep’s blood (Thermo Fisher, R060312). The plates were incubated at 30°C for 72 h and imaged above a white light ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min and labelled with Alexa Fluor 647-conjugated phalloidin (Invitrogen), during 45 min on the dark ...
-
bioRxiv - Microbiology 2021Quote: ... and OAS3 knockout cells were described previously [21] and African green monkey kidney Vero E6 (ATCC CRL-1586) were all maintained at 37°C with 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) (Gibco) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated at 30°C for 45 mins and then stopped by adding 120µl of STOP buffer (0.3 M NaAC, 5 mM EDTA, 0.1% SDS, 40 µg/ml linear acrylamide (Ambion 9520)) and 1 µl of Proteinase K (20mg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... MCF10A (CRL-10317) cells were cultured in DMEM /F12 Ham’s Mixture supplemented with 5% Equine Serum (Thermofisher Catalog # 16050130), EGF 20 ng/ml (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... entry vectors were recombined with the adenovirus type 5 destination vector pAd5-CMV-V5-DEST using LR Clonase (Invitrogen). pAd5 vectors carrying candidate gene vectors were further sequenced to confirm gene identity ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated with transfection complexes for 5-6 hours and then replated onto #1.5 coverslips (Warner Instruments) coated with Collagen IV (Gibco). Cells were imaged in DMEM/10% FBS ...
-
bioRxiv - Biophysics 2021Quote: ... at 37°C with 5% CO2 MCF-10A cells were cultured in DMEM/F12 medium (PN:11330-032, Invitrogen) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... washed two times and suspended with Williams E medium supplemented with 5 % CCS and 1 mM glutamine (Invitrogen, CA). To separate live from dead cells ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2020Quote: ... The SYBR green qPCR reactions contained 5 µl of 2× Maxima SYBR green/Rox qPCR Master Mix (K0221; ThermoFisher), 5 µl of diluted cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... and HEK293T/17 cells (ATCC, CRL-11268) were grown at 37°C with 5% CO2 in Dulbecco’s modified eagle medium (DMEM, Gibco) supplemented with 10 % heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... animals previously injected with vaccine or PBS where injected 24 hrs before sacrifice in the same footpad with 30 μL of 0.5 mM 5-and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen). For assessing migration after 24 hrs ...
-
bioRxiv - Microbiology 2019Quote: ... VA) cells were cultured at 37°C with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen, Waltham, MA) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: Py-3Y1-S2 rat fibroblast cells were cultured in Dulbecco’s minimum essential medium (DMEM) containing 5% fetal bovine serum (Gibco, Thermo Fisher Scientific K.K. ...
-
bioRxiv - Cell Biology 2020Quote: ... 5×103 BHK cells were plated into each well of a 96 well tissue culture plate (NUNC, cat# 167008). To determine the titer of VSVΔG-AFF-1 ...
-
bioRxiv - Plant Biology 2019Quote: ... urartu was labelled by nick translation with ChromaTide™ Alexa Fluor™ 488-5-dUTP (Invitrogen; C11397; coloured green), 2 ...
-
bioRxiv - Bioengineering 2019Quote: ... was biotinylated using a 5:1 molar excess of Ez-Link™ Sulfo-NHS-LC-Biotin (Thermo-Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Genomics 2021Quote: ... we extracted total RNA from rosette leaves of 4-5-week-old plants using Trizol (Invitrogen, cat. No. 15596026) according to manufacturer’s manual ...
-
bioRxiv - Genetics 2020Quote: ... 5-10 μg of backbone was digested using 1 μL Fastdigest Eco31I (aka BsaI, Thermo Fisher Scientific, cat. FD0293) or Fastdigest BpiI (aka Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Genomics 2021Quote: ... were maintained in a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Gibco; 11965092) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were incubated for 1 hour in a solution containing 5% FBS and 1:500 primary antibody (H3K9me3; Invitrogen rabbit polyclonal 49-1008 or H3K9Ac ...
-
bioRxiv - Neuroscience 2020Quote: ... Small aliquots (5 µL) of purified melanopsin was injected into a Fusion Lumos tribrid mass spectrometer system (Thermo Scientific). The HPLC column was a Dionex 15 cm × 75 µm Acclaim Pepmap C18 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples for DNA and RNA analyses were filtered (∼2 to 5 L) through triplicate 0.2 and 0.1 μm filter towers (Thermo Scientific™ Nalgene™ Rapid-Flow™ Sterile Disposable Filter Units with CN Membrane ...
-
bioRxiv - Microbiology 2020Quote: ... pylori was cultured on Trypticase soy agar with 5% (v/v) sheep blood (Thermo Fisher Scientific, Waltham, MA, USA) for 2 days at 37°C in microaerobic conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... buffer B: 0.2% formic acid and 5% DMSO in acetonitrile) in a Dionex Ultimate 3000 LC-system (Thermo Scientific). Peptides were then analyzed using a LTQ Orbitrap Elite mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: MyoD hiPS cells are seeded on 5µg/ml laminin-521-coated (Biolamina) in 5% KSR medium composed of Alpha-MEM (12571-063, Gibco), 5% KSR (10828028 ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...